Description :
From Genome Similarity Track
Location :
Scaffold_24:47329- 49262
Transcript NameFunction/comments
Hyaar_Emoy2803879PUG domain-like containing protein, partial
Hyaar_Emoy2803880carbohydrate-binding protein, putative

Sequence
1933 bases(100 bases per row)
GCGGTATCATGGACCTACTCATAGCCAGCGTTGCAACTTCTTCATCGACAGTCTTCTCGTGTCCTGCATGATGCTATCCATACTCGAATTACATACCGAT
AAATCTGGATGTTCGATAGGACATTTTTTCACTCACCTCTGATGTTGCGTAAGTTTGCTGTGACAAATTAGCATCTGGTGTTGCAAATTTGGAGTTTTCT
GTACCGTCATTGCCAGACGCCACAGCAGTTGCTGGCTCCTTATCGACGGTCAACTTTATTTGCTCTGGTAGAACACGCTTGGAACCGGAAATGGGCACCA
ATGGTTCCGGGACACTCGTTGTGCTATTCAACAGCGGACTGGCTCCCGCGATACCACTACCTAAGCGGTATCCACCAGCAACGCTTTCGCCGGAGCCTTC
TGTGTCACGAGAAATCATTCGAGACCCGCCTGTGACGGCACCACCTGAACTCGTCCAGTCCAACTCGTTACACTCCTTTTCAACTTGCCGCACTAGCTGG
TAAAAGTTGCTGTCGTGCTCCGAGTGTACCTGCACGACATCCACAGTAAGCGTTTTGTAGTAAATTATATAAATGAGTACCTGGGCTGAACTCACAATAT
GCGAGAGCTCGTGAAACAGTACTTTCTTGATGCTGTGCATAATCAAGTCAACCTGTCAGCACCAAGTTGAGGCAGCATTCCCTCTAACGCACACACCTCA
AAAGCTTTCGAAACCCAAGCAAATCATCCGTGCGTAATCGCAGCAAGATCTTCTGGCCTTTGTTTTGATTCAATCCCAGCACGCACACCGGGTCCACTCC
AACCTTTCCATTCGCCGGCATCTCAGCCAACACACCCACATTCCATCTACCGACACCAAGCACATGTATACAATAGATAAAAGAAATATGAATCAAGCAC
AGCTCTTAACTGTGACATCATATATGTATACATATAGCAACGTACAACAACGTACTTGTGTGTTGCCATGACAGCCAAAATACCTCGATCGTTCGCCAAC
GTCTCTAAAATCTCTCTCGCTTTTTCCTTATCGGCAAAATTTGGCAGCGGCTCAATCGCGTGAAAACGATAGCTTGATCCTGCTGCAAAATCTCGTGCTT
GTAGCCATTTGTTCCGTTTCAATATATTCACTTCAGGTCGTTTTTTGCTGCAGCCACACAAAAAACGATACAGTCACATCTTTGTACCACTACGGGCAGC
AGTTTACTTATGTTTCTTCTATGTACCGAATAATCGCCTTTTTCTGCTCAGCGTCTTGAATGGCCTTCATGTCACTAATCTGAGACAAAGAAGCGCCTTT
GACCAATAGCAGCGGCGCTGCGTCGTGTCGGCAATTGCTCATTTCCACCAGTTGTCTTGACCCATCGCTGCAATCGACGCGTCGTCGCTCCTGGAACAAT
CGCTGTGTATCGGGTGACACGCCTGTTGCCCGTTCAATTTCTGCTTGTAGATCAGCGATTGTCGGTACAGATGCATCGGAGAAGGACAGACGGTGCAATT
GGCCTTTGTAGGTCAATGTGAGCGTCGTCATGGTAAGAACAAAATGCGTGTCACTTGGTTTCTGTATCGGAATCGAATTCATAAAAACGCATTGATATGT
CCTACCTGGTATGATATCCCTCTAAAGTACGAATGAAAAAGCCAAAAAGGTCGATTTGACCCGATTCGTGTCCAGGCCGCGCGCGTTCTTATTCGAACGA
GAACCGACGCGTAATCAATTTTCACCACTCGTTGCTCGCGACGTTTCCAATTTCAACCAATCCCGTACCCCGATCCACTCAACGCCCCTGCTTCGCGTTG
CTCCCGTCGTCATGGCGTCGGACCTCGTCCCGTCCGTCTCCACGCTGCTGCCAAGCGCCAATCCCTCGGACGTGATCGATGAAAACTGCAAGGAGAAAAA
GGAGTCGCTTTTCCCACCACCTGGACGCTCTCA