Description :
From Genome Similarity Track
Location :
Scaffold_41:47314- 53695
Sequence
6381 bases(100 bases per row)
TGTAATGGGCCCCTCCATTACATAAGTAGGTAGATTTCTTTACAAAAGTAGGTGCATCAGCACACGACTAGAAATGCTGTCATGCCATTGGCTGATATAT
GGGGAGCCAGACCCATTATTAGCCAATTGGACTATGACGTGTATTTGAGTGGCCAGGGCTGTGGCCTTGGTCCTAAAGTAAAGTCAGAGTTGATTTTTCC
TTAAACCTAAGACTCAGTCGTCCTATTGCGAGCTTCCTCAACACTATAGTGTAAGCAAGTAACGGAGTAAATACCTGGCCCGTTACACCTGGTAGCACTT
CGTAGTCCTTCCAACGACCAAGTTCGACATGAGCCAAGACCTCGACCACGCTGCCTTTCTCCATCTCACTCGGATCGAGTGGGAAGCTCTCCACCGCCTT
GCGGCGGTGTCCGGAGAAGCCGTCGTCACGTCGCTGCTGCGCTCAGCGACTCCCGACGAGCAGCGCGTTGCGGCACAAGAATTCATGGAACGCGAGTTCG
CCGATGCGAATCGGCGAGTGTCAGCTCCCTCGCGTATCTCCACGAATGACGTCGTGAAGCTAGAGACGTCCACCTACTCCGGTGCCGGAGAAGATCGACT
TCCGCTGAATCGCTGGTTTCGAGAGATCGACATCGCCATCGCCTCGAGGTTGATCGAGGCGCCTTCCGCGAAGGTCCATTTCCTCCTCTCGCGGCTGTCT
GGGAAAGCCAAGGCATGGGCTCTCGGCAAGTTGGTTGTCGATCCCAACGTCTTCCCCACTCTGGATACCCTCCAGAGTGACCTTCGGCTCGCGTTCGAGC
CGCCGCAAGATGAATCCCGAATTCGGGCAGACTTCTTCGCCCTTCGGCAAGGCACGATGACTATGCGCGACTACGTCCAGAAGACACGACACCTCGCGTC
GTGCATCTTGTCTAAGCCGATCGATATGGCCTCTCAGGCTCATGTATTCGTGTTCGGTATGCGCGAAGGCATGACGCGCTACTGCCTTACAAGATCGGAC
CCCTCTACGCTCGAAGAGGCCTTCGCCCTCGCCCTGCGCGAGGACTACGTGGTTGCGGCGTCATACGCTCACGCGCTACCTGCTTCTGCTCGGGATTCTG
CGCCCGAGCCCATGGACATCGACGCTATCGATGCGACGAGCAATCATCAGCGTTATGCAGCGCGTCGGAGCGATGCTCGAAACAATCGTTCTCTTACCTG
CTTCCGCTGTCGGAAGGTCGGTCATCGCGCGGCGGAGTGCCGCGCGCCAGCTCGCTCGGCATCGACATGCGCAAGCAATGGAGCTTTAGTGCTTGCGCAT
GTCGATGCCGAGCCCGTGAGTTCTGACCAGCCAAAAAACGGTTAGGGTCAGTAGGTGCGGGGCGCCCTACTGGCTGGAATGGAGGTCCAGGTCCCCCGGT
GGCAACCCAACCTCCTAGCCCTCCTGTGCTGCATGCACACTTTCATGCCACCACCACGCCGAGCGATTCAAGATTGATCATTGTCAGTCTTCATGTCGCC
GGTGCCTGGCGACCACTGCGAGCGCTCCTTGATTCAGGAGCGACCAACAACTTCTTCCGCGCGTCGTGCTTGTCGGTACTCCCGTCGGACATCACTGTCC
GCAAAGGTAGAGGGGAGGTCGCTGTCAAGTTGGCCGATGGGAAATCACGCCGCGTCGCGCGGCGCGAGATTACCCTTTCGTACACGTTCGACGGTTTCCG
AAGCAACGACGACTTCCTCGTCATTGAGATGAATTACGCGTTTGACTGCATCCTGGGTATGCCGTGGCTGACGCGCTATCAACCAGAGATTGACTGGTTG
GTCCGGTCGGTCAAGCGCCGCAGTGATTATGATGTGAGCGAGGTGTTCACGCACCTCCTGTCGCCCAGAAGGATTGGCCTCACGTCACCGTCGTGGACCG
GTCATCCACGACGCACGTTGTGCACAGAGTGAGCGATGGCCCTCTCTGCTCGGCTTGTGCAGTGCTGTTAATTGATGAGTCCTCGCGGCGACGCGGGGAT
GAAGATCAACCTGGGCTGTCGAGCAGGGTCTCCGCAGATGTACGAGACGGCGTGGAGCAGGGGCTTCCGGCAGGAGGAATGAGATGGGGCGTTCGAGCAG
GGGCTCCGCAGACGAACGAGATGGCGGTCGAGCAGGGGCTCCCGCAGACGAAACGAGATGGGCGGTTGGAGCAGGGGCTTCCGTTCAATGGAGCCGGGTG
TTCGAACCAGTTGGCGCTCCCGCTGAACACTACCGCGGTCGAGCAGGGGCTCCCGCTAGAGGGGGGTGACATCTCGTCCAGCGAGAGCGACTCATCATCC
TCGAGTTCGCACTCGAGGCGGCGAAAGAGGAAGTCGAAGCGGCGTCGGCTGAAACCTCGCCGAGAGCCCGTACCAAGTGACAGCTCACCGACGGAGTCGG
TCTGCGTGCTTGAGTATGTGGAAGGTACCTCTGGCCGCCGACGAACACTCGAGCTTGCAAACCCGCCTGGCGAGGCAGGGTCGATCACTCGACTTTCAGG
TCTCTCCTGGAAGAACTTCCTTCGCGGCCTCAAGGACGATGAAATCGAACAGGTTTGCCTGATCACCGACGCCGATTCGGCGTCGCTCGAAGTGAATGCA
GTCAGTGACGGCGACGCTCCCTCGCGCCCAAAGAGCGCTGAGCCGAAGTCGGCCCGCGAGGAGCGCTTCGCAGCGCAGTCTTGGGACGCGCTACGCGAAT
CCGGCAATCCAGTCTACGAGACCGCCCGCGAATATGAAGATGTATTTCCGGATAAGATCCCAGCTGAGTTGCCAGCTGACCGAGGAATTCGCCACGAGAT
TGATCTCGTGCCCGGCTCGAAGTATTGTGTGACGCGGCAGTGGCCGCTCCCGCGAGATCAGGTCCAAGCTATCGATGACTTCTTCGAGAGCCGCCGCAAG
GCGGGTCATGTGCGTGAGAGCACATCGCCGCACTCCAGTCCGACCTTCTGTGTGAAGAAAGCCACGGGCGGATGGCGCATCGTCCATGCCTTCAACAAGC
TAAACGACGCTACCATCCCTGCCCAGACGCCGATTCCTCGGAAGGACATGGTGCTCGACGCAATGTCGGGTAGTGAGGTCTTCAGCGCCATCGACTTGAC
CGATGGGTTCTACCAAATCCTCATGAGGCTGAGCGATATACCGCTCACAGCGGTAAGAACTCCCAGTGGTATGCTCTGGGAGTGGCTTGTTATGCCGCAA
GGGTTGAAGAATGCTCCCGCCACGTTCAATCGCATGGTATCCCATGTGCTGCGCCCGCTCCGCGACTTCGCACCGAGTTATTTCGATGACATCTTCGTAC
ACAGTCGCGCTGAGGGAGGCCTCAGCGCGCTTGAAGTCCACTTGAAGCATCTGAGGCAAGTCTTCCAAGTGATGCGCGAAAACAAGCTGTATGCCAACTT
GAAGAAGTGTATATTCTGCGCGCCGGAGATTCCGGTGCTTGGCTGCTTTGTGAGCAAGAACGGCGTCTGCGCCGACCCCGAGAAAGTGACGTCGATATGT
GCGTGGCCTACGCCACAGAATCCCACTGAACTGCGTCAGTGGCTGGGTCTCGCAAATTATCTCCACAAGTACACGAAGAATTACGCCGGATTGATCCAGC
CGCTCTCTTCGTTGTTGAAGAAAGATGTGTCGTGGTCGTGGACTTCCGCACATCAAGCCGCCTTCGACTCGGTGAAGAAGAGTCTCGCCGAGGCCCCAAT
CCTCGCGCTCCGGATGACTCGAAGCCTTTTCACGTCGTCTGCGACGCGAGCGATTTTGCCATCGGCTGTGCGCTGATGCAATTCGATGAAGAAGATCGAG
AGCGTGTCGTAAGCTACCAGTCTAGGCAGATGAAGCCCGCGGAGCGCAACTACCCTGTTCACGACAAGGAGCTCCTTGCGATGCGCTACGCTCTGATCAA
GTTCAGAGTGTACTTGTTGGGTGAGGATACCTTCGCGGTGTACACCGATCATGCATCGCTGAGGACAGCGATGAAGAGCCCTCATCTCTCCCAGCGGATG
GCCCGCTGGCTTTCGTTCTTCTCTGAGTACAACTTCGTTGTCCGCTACAAGCCCGGCAAGAACAACATTCTCGCCGACGCTTTGTCTCGGCGTCCCGACT
ACGACCCACGCGGTGCATTGGGTCGACAAGCTTCGCTGGATGAAGATGATATAGACGAGTGTGCCACGTGCGAGGCGTCAGGCGTCAACCTGACGAGCGT
CTCCCCGGTAATACCACTTCGCGACAAGATCCGAGCTGCTTACGAACATGACTCGACGTGCTCCAGTATCCTGAAGCATCTCCGCTCTCCCAGCGCCGAC
ACACTGGGAGCCCTTTCCCGCTCTGTACGAAACAAAATCCACCGATATCGTATCGAGGACGAGCTGCTGGCGTACAACATCGACAACTTCGATGCCCCAC
GTGTCGTTGTCCCTAGCGACCCCGATCTGCGCTCACGGATTATCCATGAGTTTCATGATGCCCCGCTGGGCGCTCATCTCGGTCGCGAGAAGACATTTGC
CGCTGTGTCACGCGACTTTTATTGGCCACACCTGTACAAATGGGTGCGTAAGTGGGTGCGCACCTGCGAGACCTGCCAGCGCGTGAAACCTGCCTCGTCT
TCGCAGGCTCCCTTGCGTCCTCTACCAGTGGCCACCGAGGCCTGGCGCTCGGTGTCGATGGACTTCATCTTCGGGCTCCCACCCGATGCTAAAGGACGAT
CAGGTGTCTTGGTATTCGTAGACCGCTTCAGCAAGATGGTTCACCTGATTCCGGTGTCGGATGCGATCACCGCGGCAGATACCGCGGTGCACCTCCTCGA
TGCTGTCTTCCGTCATCATGGCCTTCCCGAATCTATCGTCTCCGACCGCGACCCGCGCTTCACGTCAACCTTCTGGTCAAAGCTCTTCGAGCTACTGGGC
TCGAAGCTAATGATGTCCACAGCAGCCCATCCGGAAACGGACGGTCAGACGGAGCGCGTAAATCGCGTCCTCGAAGACGTCCTCCGAAGCTACGCGACGT
CGTTCTCCAGCTGGAGCTCGTTTCTGCCACTGGCCGAGCTCGCTCTGAACAACGCGGTACACGCGTCGACTGGGCTGACGACCTTCTTCGTTAATAACGC
GCGACACCCGCGTGTCCCTGCTCTCCTCGCCGTGGGCCATCCCACAGCGCCGTGTGTCTCCACTCTGGGTGGGGAAGAAGCTGCCGACAAGCCGTCTACT
CCATCTGCGATGTCTCCGGCGGCTACACCGGTACTGGGTCAACCGGTACATACACCGGTTGCTAATGATATCTCGAGTGTATCCCCTGTTCCCACGTCGG
TCAACGCAGTGACACGCTCCGCATCGAGCTCACTTGCGCAAGCTAACTACGCGCCGAAGCGTGCGGCGCGACCAATCGACTCCGCAGTCGTCTCCGACTT
CGTACTACAGGGCCAAGCGGTCACCCGCTGTGTTCGAGACGCACTGCAGGATGCAGTGGACAAGCAGAAGGAGAACGCCGATAGGATCGGCCGCAAGAAC
ACGGCCACGTTTACGACAGGCAAACGCGTGCTCCTGTCGACTGAAGGTATCAGAAACTCTGCGGTTACCAACCTCGGCGCGAACAAACTCGCGCCGCGCT
TTATTGGGCCATTTACGGTAATCAAAGCCATTGGTGATGCCTACACGCTTGACATTCCTACGTCACTACGTCTGCATCCGACGTTTTACGTCGGACGGCT
CAAGAAGTATCACCCCGCTACGATTCCAGAGTCGTCTGAGGCTACTGAGCCGGAGCATGCGTCGAGCGACCTTCTCGACGGGCGCGGCGAGCCATCGACC
CATCCGCACCAGGAGTCGGATCTCGAGGCTGCGTCCCCGTCTGCAAACGTCCGTGAACCGACCTCTTCAGCATCTGCAATCGAGCAAGGATCTCTCGGTT
CGACTGACGCAGCTGCGCACTCTCCCCGGTGGCCCGGGCAGTCTGATCGAGAGCCTCATCCAACTCCTGCTGGACATCCCAGTAGCTGTTCAGCAAGTCG
TTCTCGCTCTGGGCAACCAGAGCGCGAGTGCTATCGACGCGACGGCCCTCCTCCTGTTGTTGACGCTGCCGGAGATACCCGCTGGATTGTTGAGTACATC
GTTGCCAACGAAGATCCACTTCGCGCTCCCAAACGTCATCGTGGGCTCGCCCACGATGTTCCAGCCCGACCGTCGCTATCGGGTACGTTGGCTCGGGTTT
CCTCCCGACGAGGATACGTGGGAGCCTCGCGCCAATCTCCTTCGGGACGTCCCGAATGTGGTCCAGGCGTATGAGTCCAGCCTCGCTGCAAACCACCTTG
TGACACATGCCAGCTCGCACGAGGATAGCGACTCGAGCGATCACGCGAACGTGATCGAGACCGATGACTTGGTCGGCCACG