Description :
From Genome Similarity Track
Location :
contig_38:473129- 474589
Transcript NameFunction/comments
g8819.t1hypothetical protein

Sequence
1460 bases(100 bases per row)
TTCATGTCGTTCGTTATAAGCTGGCAAGCGAAGCCGATGTTGATAGCCGTCTCCTCCTTGTCACCAGTGAGTACCCAGATTTTAATGCCCGCACACGCCA
AGTTGGCGATTGCGTCAGGAACACCAGATTGCAATTTGTCCTCGATTGCAGTGGCCCCAAGCAGCTCCAAGTCGCACTCAATCTCGTTCATACATTGGTC
AATTGCGTTTGGGAGGTCCTTCTTTCGCTTGTCGATTTCCGCTAGGTTGTTCTGCGCGTCGTGGAACCTTGTTGCCCATTCGGCGTAATACGAACGCTCA
ATTTCACGAACCGCAATCGTCAGAGTCCGCAGTCCGTCTTCAGCGTATTGGTCGATATGGCGCCGAGTGATCTCCTGGAGCTGGGAAGAAGTAGATTCGT
CCTCCTTGTCCTTCGCTAGTAATCCGTAGATGATAACATCTGCACCTTTGGAGTACAAGAAGATCCGTCCATTTGGGTGACGGATAATCGTACTCATACG
CTTTCGCGTACTGTTGAACTCGAGAACGTCCAGCATCTCGTACTTTTGTACTATTCCACGAACTTTGACATGAGCGACACCCGGAGATCGATTTACGAAC
TCATATCCAAAGTAACCTGCACCCGCAACGAGTGCTTGTTCATCAGGAGATGAAGCCGACAGCGTGATTTCTTTGGAGTTTTCATGCCGCTCTGGGATGA
CGGTGTGACAAACTGCAAGATGCGTGAAGAAGGCATCAATACGTCCCTGTTGGACGGAGCCTGAGTCCCCCTTCATATCATTAAACAGCTCGGGACCATC
GAAATTTACGTAAGGAACCTTGGGCCCCGTAGACTGTGCGGTCATATCTGGAAGGGGTTTGCCGGCACGCCTTAGTGCCGCTAGCCCGATCTCAGTGGTT
CCGTTTCCGTAGGAGACCCCGCCAATGGAGCACTTCCGGAACTCCATGACGTTGCAGGTGAGTGTTCCCGTTTTGTCCGAGAAAATGTACGAAATCTGCC
CGAGCTCTTCGTTGAGCGACATGGAGCGCACTAATGTCGGGGTGTCTGTTTCGGGGTGGTAAATCTTGATGTCCCACTGAATAAATTGCGCCTGGAGATA
CTTGACCATGCTCATGGAAACAGCAAGTGAAATTGGCACGAACTGGTACATGAGTAGCAGATAGTAGAATAGCATGACAATCCAATCCACAAAAGCGCTG
TTGTCGGACACGTTCATTTCCAAGTACCACACAGAACCGTTGTTCGCCTTCCAGGCCACCGCTCCTGTTGCACCTACAGCACTGAAGACAATCAAAATTG
ATAGCAACACAACCGTGTACCGGTTGATCGACCGGTCCATGGAACTCATCTTAGACGGAGGCGCCGAGTTGCTCATCATAATCTTCGTGTCCTTGCCGGT
GTTGAAAACCATACCGTGCACCCAGTCGGTGTTTCGGATGATACAGCCACGCAGGATGAT