Description :
From Genome Similarity Track
Location :
scaffold_83:47310- 52308
Transcript NameFunction/comments
g3070.t1hypothetical protein

Sequence
4998 bases(100 bases per row)
ACTCACAGGAATTCTAGCTTCGTTAGCTGCGCAAGTGACGATGGAATAACCCCCACAAAGTTGTTACGGTCGAGACGGAGCGTGCGCAGCGCACTGAGTC
GTGACAGTGTATCGGGCACGTAACCACTCAAGAAATTGGAGCTCAGGTCTCTGGTGCAAAATACCACATCGATGAGTTCACAGCAATGAAATCCCCTTGT
TCATCGTGCCTAGACAAACTCACAGCTCTCGCAACCCATTGAGATCTTTACGGGGGAAATCTGAAGGTAAGACCCCCACAAGGTTGTTGTTTGGCAGACG
GCTGCTCCAGCATCAAAGTCAGCTTCCCATTGGACCATCCAGTCTCAATTGCACCTACATGGACCGGATCCGGCCATTGCGATCGCACACGATGCCGTAC
CACTGGAATGTATCGAGTTAGTGATGTCACGAAGAGTTGAGCTTGAACTCAGTACTCACACTATCGAGACACGGGTCGCTATGCTCGTTCTGAATGGCCC
ATTGCCCCACCCAGCGCTGGCCCTGAGTGGCCCAATACAGCAACTTTAGAGCGCCACGCTCGTTCCGTGTGACAGCCACAGCCGAATTCATTAACGACAG
CGTCAGCAACAGCAAGAACAAGGCAGCGAGTACATTCCGGTGCATCGTGACAAGTGAACTGATCAGCTTCAACGTTGTTGACAACATGCTACAAAAATAT
TTTCGTACTTAGAAAAGTACTCCAATACCACATATATATCATTTCAGAGGTCCAGGCATTATCTGCACCGACGAGGAGCAGCGCCGCCGAGATGCTGCTG
GAGAAGCCCGAGGACGTCAAGCACGAGAACTCTACGGGTACAGGTAGGTGCTGAACCTGTAACTAAGACACTCGTCTGGATTATCCCGCTCTCGCGGGCT
CCATATTCGCTGTGGTTGCTGCGTTCTGACGTGATGAACTCGGACGATGCATGTATGACATTTTGGTAGTATGCGCTATCTACGGCGTGGACGCCCACCC
TACGCTGCAGCTGTTCGCTACCGCTGGAGGAGACAACACAGTCAAGATATGGTCTCTACAGGAGCCACAGGAAGGAGGAATCGCCACGTTTGAGCTGTTG
GTCACACTGGCGAACCACCAACAGGCCGTCAATTGTGTCCGCTGGGCTGGACACGGCCGCTATTTGGCCTCAGGCTCTGACGACCAGTTGGTGCAGCTAT
ACGAGCTACAGGGAGGTACTCCTGCCCCTGTCCCTTTCGGCTCCAATGCTCGTCCTAATAAACAGAACTGGGTTCGCTGCTCCACGCTCGAGAGGCACAC
AATGGGTAAGAAGACAAGGCTTTCTCTCTGTCTGGCTTTTTGAAAAGGTGCTGATACTGGTGATTATGGTGCATTCTAGATGTGGCAGACGTTGCGTGGT
CGCCGGACGACCGCATGCTGGCAACCTGCAGCATTGACAACACCATTTTGATCTGGGACGTGGGCGTCGGTGCACTGAGTGAGGTGATGACGCAGCCGCT
GCAGACACTAACAGGCCACAATGGCTGGGTAAAGGGCGTCGCGTGGGACCCTGTCGGAAAGGTGTGGGAACGAGTGGTTCAATGAGAAAGAATTGTTGTG
GGTCTGACGTCTGCTCGATTACTTTGTGATGCAGTATCTATCGAGTGCCGGAGAGGACAAGACTGTGCGGATGTGGAAAGTTGCTGACTGGCAGGAATCT
GACGTGGTGACGGAGCCATTTGAAGGATGCGCCTCCACGTCGCACTTCCGCCGGCTTTCGTGGTCTCCTGATGGTTCAGTCCTCTGTGCTACCCACGCTT
TCAGTTCCAAGAAGAACATCGCGGCTTTGCTTAACCGTGGAGCGTGGACCAATGACCTTAAATTTGTGGGCCACCAAGGCGTTGTGACCAGTGCGCGGTT
TAACCCCAAATTACTTGGTGCGTTGAGTAGTGCCACGGGATGATACTATCTTACCGTGCTAATATTTGTGTCTTGTGTACTGCAGTGACAAAGGCAGACC
CGGATAAGGAGTTTGCATGCTGTGCCGTGGGTGGTGAAGATGCGACTGTAAGTATCTGGCTGGCACATCTAGCACGCCCATTGGCAGTCATCAAGGACTG
CTTCGACTCGTCGGTCACGGACCTGACTTGGTCCAGCTCCCAGTCTCTTCTCCTTGCTTGTTCGCTGGATGGGTCTATCTGTTGCTTTCAGTTTGCAGGA
GACGAGATTGGGACCCCCATCTCCGATGCGCAACAAAGCAAGCTTCTCCAGGCAAAGGTATGCAGGTAGTTTCCCTTACACACCACGTGGTATTTATTGA
CGTTGCTTTCTTAATTATTTGCTTTGCATTCAGTATGGATCCCGAGCTGGCATCACACTCGCCTCAACTCTGGTGGAGAATCCCATTCAACTTCAGGTAC
AGTCAATTTTGCGCCAGTTGGTGTGGGACGAGGTAGTTGACGAACGGACATTTGTTTGTAGCTTGAAGAAAAGTCGACGACTTCACCACGTTTGGCGGTT
AATCGAAATTCTGGACCAAGTGCTACGCCAGCCGTGACGCACACAACGAATACACTCGTTCCGAAGAAAAAGAAAAAGATTGGTACACAAACACCCAGCG
CTGTGCCAAACAAGCCGCCCAGCGGGGCAAGCCAGAACGACAAAAAGCGGATTTCCCCAGTACTACTTCAAACGGCCGCGAAGTCTTCAGTCAACAACAA
TCCAGCTTCATCGCGAAACAATATTCGCAATATCCTGGGCCCGACTATCGTGTCACCAACCGCTTCGGATGTTACACTCTTAGACGCTCGGATGGCTTCA
GCAAGTGGGAAGGAGGTTAGCGTTGTTCCTGACGCAACTAATTCTGCTACGATCCAATCAAACTCCGCACCAAACCTGAGCGAGAAGACTGGAGCTGCCC
CTAAGGAGAAGCCGTCTCCAGCGACGACAAACGGCACGTCAGCTAGACCGTTAAAGCCGGAAGTGAAGAAAAATGGAGTTGATGGGGGCTCCTTGAAGAG
AAAACGAGAAACTGAACGTGCTCCAATCCAAGCTGCTACAGTGGTTGCAAAGTCGAGGGAAGTTGCGGCCCGACCACCGAAGCTTCTGAATGAAAGGTTT
GTTAAATGCCATTTAAACTCCGATGTGGAAAGCTACTAACTCCGTCGTACAGTAGTGCTGGCGTGGCTAGCGGAGGTCAGTTACTGCCTGAATTTCCATT
TAGACTGCAGTTCTCTGTAGAAATGGATACGAGCGCACAATCCAGCATTGCCAATGTCAGCTCCAGTGGCAAGAAAGGAAGTGGATTGATGCCTTCTAAA
GCGGTGGTGGAAGTTACTGTTCACAACCTGAAGAATCCTCAGCCAGAAGAAATCATAGGTGAGTCACAGCTACTGATCGCTACGGGTCTTTTGTGTAAGA
ACCACTGACACTCTTGATCTCACTACTTAACAGAGTTAGGCCCAATTTATTCAACCTTTAAATGTTCCGAGGGAAGCGAGGTCAAGTGGATTGACCGCAT
TCCTGGCCGAGCTGTGTGCGCAGTGGGAAACGCGAGATATTGTGCTATTGGTGTACACAACGGCGACCTACTTGTTCTTAACACCAGCGGGAGACGTCTG
TTTCCGTGCATTGGTACGTACTTCAAAGTATATGCCGCCTTCGCTCGTGTCTGTTCAGAAACTGACGCTCTCCGTGTTGCTGCTACCGGTACCAGCTCTG
GGCAGTGCTATCTCAGTAATGGAGTGCAGTGTGGGCGAGTCGCCCTATTTGCTGGTGATCCTGGTTACAGGTGATCTCAGAATCTGGGATCTAGCACAGC
GCAAACTTACGCTCTCGAGCTCAATAGAGGCGATTACAAATGTAAGTTTGAACTTCATAAGCATAGACTTGATTTCTGACTTCTTGTACGATGTCGTAGA
TCACGCCAGAAGATCACCGGAAGCTGACACTTCTCCGGTGCCAGGTGACAACCAAGGGGATGCCACTGATTACGTTTGCAGAGTCAAATGCAGAAACGAA
AGCGAGCTCGAGCCTTCTCTCATACACATTTGACGCGGGGATGTCAGCATGGTACGACAGGCCTGATGATTGCGAGTTTTACCCATTCTTACTGTATTAT
TCATGTTTCTGGTGTAAATTTGTGTAGGATGCGAGTGGCAGACGACAGCTTCGTGTTCTCGGACTTCGCGTCTGCTCTGCCGACAGACGCAGTTCGAGTC
AAAAGTGTTCCTGTACGAATTTGTCGTACAATTTGCACCTGCTGACCAGGTTAATAACTTACCGATGTCCATTTGTATTGCAGATCGGACCACTGCGACG
ACTCCAAAATGCCTCTGGGTACGGCCGAGCACAGAGAGGTATCGCTTCGGCAATGCTGTCGAGTATGTCAGACCCGCTGATGCAGCGTAACGTGACGCGC
TCGCACCTCGAGCACCAGGTCGCGGCTGCGGTTATCCTAAAAAGCTCTGCTGAATATCGCTATTGGTACGTTTAAGCTCTGCAATCGTATGCACCATGTT
GGTGCTGATGAGTTTTGAGTTGCGTACTTGACCACAGGATTCAAGCGTACGCGAGATTCTTGACGCATGACGAGGATGTGACTCGTCTGGACGACTTGTG
TGCTGAAATGATGGGGCCCTTCCACTCGTGCGTGCTTTGTAGTACTGGAGGTGTAATTGATATGAGTGATACTATGCTAAATGCTGTGTGTTCTGTTCTT
CAGGCCGTCATCTCCAGTCTCAACAGAAAAGAAGAACGCTAGTGCCGATGAAGGCGGCGAGTGGGATCCGATGGTGCTGGTACGTTGGCTGTCGTTTCGT
TAGCAATGGCCAAGCCGCCATTGTGCCTCCATGGACTAACATTAGATTGGGAACAGGACCTCTTTAAACGAGACGTGTTGAAGTCCCACATCCTGCCGAC
GATCGCAGCGAATCGCGCGTTGCAGCGTGTGGTAACCAAGTATCAGCTGATGATGAGTGAGATAGAAGCACGGGAGAACGACGAAGAAGACGAGTCTT