Description :
From Genome Similarity Track
Location :
Scaffold_27:47309- 65052
Transcript NameFunction/comments
Phyca_LT153417329carbohydrate esterase, putative
Phyca_LT1534534687cysteine protease family C26, putative
Phyca_LT1534507344unnamed protein product
Phyca_LT1534567898COP9 signalosome complex subunit, putative
Phyca_LT1534534689Hypothetical protein
Phyca_LT153417333kinesin
Phyca_LT153417334Ribonuclease P protein subunit p29
Phyca_LT153454256GPI ethanolamine phosphate transferase, putative

Sequence
17743 bases(100 bases per row)
tccctacgtgaagctaaagcacaagacattccagtcacttacacctcgctggggccaccgaaagggtccacgcggccctcgctcgtcacgtaggccgagg
tgatgccaccatcaaccacaaacgacgtaccagtgatgtaggacgcatcgtcactagccaggaacagcgcagccttggccatctcagcagcttctccaaa
gcggcccataggaacatgcaccagtcgacgttgcttcttctcctccgagtcgaggaacttctgcaacagctcagtgtttaatggaccagggcaaagggcg
ttcacacggatgttctcacgagcgtgaatcgtagccaactcacgggacatggcgataacagctcccttactggatgtgtaggcgagctggggagtggcgg
cacccagaatgcccacgaacgaagccgtgttaatgatagagccaccaccagcacgacgcatggccggaatgccatacttgcagccgaggaagacaccctt
aacgttgatgttcatggtaaggtcccacacgtcctcttgggtggcgatagcgtcatcatcagcgctgtgcatgataccggcgttgttgaagagcacattg
agcccaccgaactccttctcggccacgttcaccatgttttccacatcgctggccttggacacgtcagcctgcacagccagagcgacagtgtcagtcttgc
cgagcttcttgagctcctcctggacgagcttcaccgtctcggccgcggcgtctgcgttcacatcagcgcacacgacgcccttggcgccttgtttggcgaa
caggatggccgatttgcggccgatgccaccagcggcgcccgtgatcacagccacttggccagccaatctactgccgatgacgctcatgatggaactgctt
gggtgtggggggtttgacgcacttgtgatactgaggtggcacgttgcagctcttgacttggatatgactaagagtcaccggacattggtgtggtgcacaa
caacttgatgaggtgacaagcgacgcgttcaacgtcactgctcacatgcggttgatgctcaagtgttgagaatcaacttgagatccagagcgaggtcttc
atttgccagaagggatcaagttggaagcgtgcctgccttggttcaagcactgcgggctgtttgctgacggtacagtctgtactaaagatgaggatggcac
aaggcaagtgcttggatggggagatcaagcacacccactaggattctgcagtgttcaactagagaagaactctagggcctaggtaggtggggtctgacaa
cgcatgctggggtccaggccaagccaagactgcattaactggacatttttcagcaacaagttaacccgcctgcgctgtataatgtacataatgtgcaagt
gcagtttcaagacaacttcaacttcgtctagccgaaatgaagacgaccttcaagctcataaaggcaaggtgagcttgcctttatgagtcaacttctgtga
gcagcacttaatgagcaccacagtgatgggcaccgctttgtgccggtgcagtgacgtcttcagtgtcgagccatcttcagtaaagaatcatcactacaga
tccagtgaagaaacttcgccatagtctagcaaacaagcaccaggaaaaataacattgctttataaaaagcttatcggatagcgtggtagcacaaggtgct
tgactcaagcaccttcatggtgccccaaggtgaccttggggcagtgaaaactaagacctctcggccgcgcattcaatggacaaatctgctgatggtgctt
cgaagtacatgtacacgtacgcgtgcactagatgcatgactcctgcatcgtcgacagcttcacactcgaggtaatgcaccggcactgggtttaaagcatc
tcctccgtcaccatctacacattccagccacaattgccacattcacaccacggaatgtaatgatgggcacttcaacttgcgcatactgaaactagtgtgg
tccactagattttatcagcctgataatcagcctgcacgcgacgtcactcacccacgtacctcggagtcaccacgaccagctccatctccgccatgctaac
tcgcttctcccgtcgtctgcgcctccaatcggccgttgtatcacgcgcactgagttcttcctcgtcttctccattgaaggtgctggtcatcgacggctat
tcacaagacggtcgagctgaccttgaagctggaggtgccagcaccgccggcaagctttacattgatctactcaacaagtcagcgcctgctggtgtggatg
tcgcctcagacgtagtttacccagccgatagcgacttccagacgcctgatctgtccaaggtaagctccgccactgctccatacaaacataatgcggggaa
ctaaacaattgctattgctttacgatttttgtttatagtaccatgctgtagcatggactggctgttcgctaacaattcatgacgccgaagatgtgcgcgt
taccaagcagattgactttgccaagaaggtctttgaggagggtaagagacacagctagtgttcccaaataccggattgaagctaacgtaggatctacctg
caaccattgacaggtattccacagtatgggagctgctgggcggcccagatcgcagtagctgctgctggaggccactgcggagcaaaccctcgcggccgcg
agatgggtattgcgcgcaagattgagttatccccggaaggccgtgcacacccgatgttcgagggcaaaccgtcggtctttgacgcgttcacgagccacaa
cgacgaggtgactcacatgccgcctggaggacttgtcctgggtggtaacagcttcacagcagtgcaggctgtgtctgtgcgtcacaagaagggcgatttc
tgggctgtgcagtatcatccggagtacgaccttcacgagcttgctcgtctgacgtactgccgccgtgctaagctcgtagacctgggcttctttgcagaca
tgaagagcgccgaccagtacgtcgacgaccttgagaacctgcatattgatccgtcccgttacgacattgcatggcgtcttggactggatgccgacgtcat
ggatgagaactcccgtcactgtgagacgcgcaacttcatcaagtatctcgcgcttccttacaaggcggctgtggaggggaagtaagcaatactaacttac
ttcaaatacaatgatgttcacgcggaatcttcattgaaaaccgtcaacaaaaggtattgaagaggactttcagctttatgatcgagtgctatcccaataa
tacatgaaattcttctgaccaccacagttttgagttgttgcgaagtatgtgaaattgacgtagtacgtgatgaagcattacatgtactacgtggatggat
gaaaaccaaatgagatgcaatagaagaagctaactagtcacccagaacgacgagtttatcgacggcaagcgcattggtaacgtgttgtacgagccttggc
gttatctacaccatacgcttactgctttccacctttcttcttggcggccttctgcatcttgacggcctggacgttcaccttgacttcacgagtgaaaggc
aggtaagtgacgccgcccatgaagggcactagtacctccgggaccttgacaccgttctcgtcctggtagttctctaggatgcagcacaccgtgcgcgtgg
acgcgcagagcgtcgagttcagcatgtgcacgtacttcttctcgcgctggttctcctttttgacgccgcaacggatctccatggcacgcgactggaagtc
cgtgcagttcgaggccgacactagctcacgatactccttgtaagcggggaaccacgcctccaggtcgtacttcttgacggcagcgttgttaagttcgccc
gagacgatgttcaccacgcggtacggcaggttcaacgactgatagaactcctcagcgtgacgcagcatctcctcgtgcatggcagcagagctctccgggt
cggtgatgcagaattgctccatcttatcgaactggtgcacgcggaaaataccccacgtgtccttaccgtgggaaccagcctccttacggaagcaggtgga
gaagccaccgtaacgcaggggcaacgagctctcagtgatccactcacccctgtggtagccgcagatgggctgctcggacgtagcaatgaggtacttctcg
tcctcaccgatgaccttgtatagctgctcatcaaagtcatcaagctgcgcgacggcagccataccttccttgttcatgaagaaaggcggcttgagcatct
tgtactgagccttcatgaggaaggtcgtggcgtaagccatcagtgcctgctccagcaggaagccgtagcccgtgaggaagtaggcgcggtgaccagccac
ctgcacgccacgctcgggctcgtaaccgtcgatacggtgcagcacctcgtggtggaagtgcagcccgtccttctcgatgggagtgccccacttcttgacc
acaatattgtcatcctcgttattcgagatgggtacagtgaggtccacagtgttgccaatcttgggcaactccttgtcaacgagcaccttgagctcgtcag
cctccttcttcttcgcaggaagcgaagcggccagctccttacgctcgtcactgagcgccttgaagtcctctttggccttgctgagcttcttgatctcctg
ctgcagcgcgttcatcttcatgctgatggtctccacctcgccctgcttcttgcgccactgctcatccagttcgatgaccttgttcacaatatccacgtcg
agcgatcgcttctgctggtcgctgcgtacggagtccgggtctccgccacgctcgggacgcaggcggttgatatcaatcggcatcttgaggctctagtgct
ggctgtggggtgcgtagcttttccacgtatgagcgtggagcgggagccatcagaagggaagatttgctattgacaccggacagggtacaaaagtgatctt
gatgtgcagatggtgacgaatacagccaatcatagattactactgacgtggtaggaatcgattgtcgcatttcgtcactgcaccacgagaaaaagacaac
ggaaaatgcttgcagacgttgaagcaattaaactgcggagcttccagataagttgtggatttggcttgaaaatatttacgcatcaacgactcttgcttgc
ataacggctgttgtctgctgtgtcgttgtcgtcaaggatcacagcaacgtgccccgctggtggtggcgctcctgcgtagttgtgaagcgatccacgacgg
tgttcgcgttagttgcgccctttgtgagcgtggccagatacgagaccaggagtgcgtcgttgtactcctgggtgaaggtcgcatcaaaatgctccgactt
catcgcaggtaactggttgcaaatgctcgagatgtggcgcagtagcttatgatctagaggtgcttcgccattcttcatcgcctgtagaaaccgaagcagc
acatccacctgacgatccaacattttcacggcttctcggacgttgcccaggtacgggtgcactgcaacaatagcagcgttaacaaattaagcaactaaag
actgcaataccagctacaacaagaaaacgtacatgtcgacttgttggcatcgccaataggtgcgatcttcgagatatgatcaatagcaatactctccgtc
tcagaagtctcgatcttgaacggcgccttaacgaagatcatcttgggtacaccgttgagcatgtgcagctctgactcaaacagcgagatcggcagtttct
tcttggtgcttggccccttagattctggatccaggatcataaacaacggactttcgttgaactccatcacctgcagcaagagcgcagttaattcatcagt
caccgacaccaccaaaacctataattccatgttattaccacgcggtgtaccgccagatcgctagaaagagccttggaaccaacagtgtaccatcccagca
gctcaaagcccgggaacacctgcgaaactgcattcacaacaacaacagaaggttacacctcccaaatgtatgaaaatgcaagtgaaaacgcacactgctg
gatgcgggaggtaagaaactccttgtcgatctggatctccccattaaccacttcgtatttcatctcgaacgagtcatagacgtccacatccagacctttc
tggatcccgaagagagcgccgatgacctgcggagcttccgtctgactcagctgcgagttgcacttctgtcgcgtctggtggtctgctacgttcacaatga
ccagcgggtggatctgaatctgccgctcgccgcctccactggctcctccgtcctcgcgctgcaccagcatctcctcatcggcacttgtcatctcggtgtc
ctgcatctttcttaatcttaaaaaactagtgtaaagtatgatgtaaatttcggtggcaatatggtccggtgacatcagtcaatccggatagtcggcctgt
ttatgtggtttatgtggcagttgtgtaccgcacttgcaattgtcggcgtgacgttcgctcgtgctgactattccagtaacgctagcagactcataaagga
actggagccaattcccccctcgagtcgtgactctccgacgtggcacttcgaggcacatcacctgcaattgtcggtatgagcgaccaagtgtcggacgatc
tgctctggtccctggatgtacgtggcaggattgacacaagtcacaactttaaaaattcttctaactctgtccgttatttttaatatgtatttacttactc
agaatctgatcaagaaagatgccggaactgacgtggagaacgatgccgatctcgtgcgtgctagcttctacacgcaggataacatgttaggctgctccat
gatcggtagcgatctggtcttcggtcgtcgcgaatcagtacggttgccgcgtgataatgatgatacaatgggaggctttggacgacccacggggctgatg
ggttacggcattgacgaagacgaactggacgatgatgagactattggacccattgaagagcgtattcctgcaacgttgagtgccacccaacctagcagtg
gcagtagctacgcccggcaatcttccagtcaacgcagtgtcagcgaagacacagacagatccttctccttcgcttctgaggaggaactcagtgtcgagag
catttcggccccttcaccacatcggaaacgctcgacgagacgcctgagtgatggagatcaggggacttatgagcagcgcatcgaggcatcacttgctgga
tacatcaccaagtcattgaacgtcgagtcgcgtatggtggcagagctgcagccggaccgaccatttactatgagcgatcttgcgcacttcaacccgcaat
tcggccgcgacgtttacctcgaacgattgggacagagtttgcaggatcaggaaggaggagggaaatcgctgggttcgtatcgtaggtccactatgcagcg
gatgtcgacaccgtcagatattattcgagagggttggatttctaagcgcggtgaggtggtcccgagttatcggaagcgctggtttacgttgcgtcgtatg
ccacaaggcccaatgttgacgtacgcaaaggacaacagcgagggtgcaccgactaaaatgattgacctcagctcgacatcacgttgcttggttgtcacag
gcaagaacgcgaaggacaatgaattcaaagtcatgacatctgccgactcttctcgacgcgaatactgtatgatcgccggatctagctacgagatgactca
gtgggtgtgtgcaattcagaacgctatcaactctgggaaccggtctacctttgacggtgccaccgacttccagcagctgtggcatgaagcgggaatacag
ggatttttagttcgctatggtattcgcaagtgcagctctcggaatcgccttcagactcgagtcttggagctgaactttgctgagcaaacacttacgaatt
cgcgacgaggggagacgctgacaacatttcatttcactgacatacgcggtatttcagtcagtagtgtgcgatcaagcggcgaggagcatggaattagcat
cgatttccacggacggcatcgatcctggccaattttcttggataccgtggaagcgagagatgacttattcgccattttacaacggattgtcgataacgtc
gtatctggggaggatcttgagaagcgatcatctcgcttaactctcaagaccggtcgcttagatacgaagaacgctggtccacatgctactctgcgtgggc
ggttgtttgtctgtctgcacgaaaattgcatcgtattttatccagcagaaggagacaccactacgaggccgtggtatgtcatggcacttcagggtcttcg
tgtttcggtccgggaagataagcgcgtactttatattggacgactggcactttcatgctcgtctgctgccgaatctcgggcctggtacgatgccatctca
gctgccatgtgcctaccttctgaaattattgagattgagctgagagagcgagcaaaaatccgcacagtgttccagtcatgtgtatcgcggctacgaaagt
tgctcaaggctaaggtgacccccgagccaaacggacccccgaaagaccagaagacggtgaatatgatgatcgccaaactgtgggaactcgtttttccggg
tgagccatttacgtcaaacaacgatcccaagtggctggagattggttttcaaagagggggtccagcgtctgatcttcgttcgagtggacttcttgggctt
tattgccttattttctttgctagctacccatcgagtgagttccagcggattctgacgcgcacgcggcatggtgtgagtgaaggcaacatgaagaattacc
ccctcgcgatcgcatgtattaatgtggcatcgatattgacggaaaccctcggctttggagacgctggtacgcactcggaggggtgctcagtaaaggcaat
gaagacatacagtctcctggttgcacagagtgttagcaagtcacggtcatcaaaaccaaaggcatactctgcgcagcgaccgctaagtgactacgatact
tgggacgatgtcgtcaacgagccggagaatcacgtgtttgagactattttctgccttctcttcccaatcttggactcgcttttcgttgagatgggagcgg
taagttctgtcaccatattgttttttgtcaatgaagtactaagtttctttgctggtacagggatacatggagtttggacaggtcaccgtcgcgttccggc
gccgggtaaacgagatttttaacgcacagcccaagtcgttaaaagaacttcagaaaatggcgaacgagccctgcactggcacactaacagtgccgacggt
gcttacgaagcagcacaagatagggaagattagtatggggaaaaaagttgtgaaggcgggtggtttgtagcgcgacgaaagcagtcgagtttctctgccc
cacatagagattttgaatttgttcggcttgcacaacgatagaaatgccatgccaagacgtcgtgaagccattaagatattcgatgttcgttcgcgttttc
ttacttatttaaatgtacgttcacaatatctggcgaattaatcatgtcatgccaccccatgcacttgtagttgcggtaccatcactattactactgtttg
atctggagagcggtggtgccatgggagctcgatgtaggtgtaaatgtctaccccttccacctccgcggcctccagagctgctacggccataatgagtgtg
gtgcggagggggttggccacggtgtccaccacctcccgaatgcacagctgtacgagccaggaaacgctcccaagcaagtttcatatcacgtaaaagccgc
acggactgctcttttgcgcgttccaaagcctacaaacgatggtgtcagcatttatacaatgaaaagcattcatgaaaagtcgacgtaccgcttcggatgt
gctagtaatctggatgtaggcttctggcatagtctgcggcgaaatagtcttgctgccgtgggatcggcccttgctccatttgttcagtgtctgcggccac
ggcccaaagtagcgtaattgagcgcacgcaatagcctcgatcctttttaagtgtacaccacgttcgcccaaaagtttgcctggaaagttaaacttgcgcg
aaacaagagcttcagtgtcaacgatgtcgtacacgttcactctcacgaaaagatgaccggatgatacagagccctcagcgctatcaccactcaacaccgc
atgcttaaagctgatgctttcgctgctcgtgctgctgttgctttcctcttggcccatctcatcttgctccattgcagatagtccaagcttcttcatctgc
cgccctcgttcttccacgaccctgccctcctcttcttttccttgaagccgtaaacacttaccgatttgttctaatggtaacacggcacacgagcagttag
aaatgactaagaaagtcaaaatgtaagtggatcgcaccgatgcaaaacccaacgtcacgggtatcaggaaatagctgttgtcgaatatcttgtgccttct
tgtaagcgttgatggcttcttcgaagcgtttctgcaatagatagcactataagttcaaagttccgacgacgagccgtgtgatggtctttgaaaaccgtac
ctgatctcgatacacccgcgcgagattaataaaaatacgagcagcacgagggctgatatcattgaaatagcgatctgtaatttgaagcgcctccttgatg
ttttcctctgccccacgccagtctttctgcatcaggagggaaacacgtaaataaaacaagatgagtaccatgtaggcttggaacctaacgcacaacacgc
accgtcaaacgcttgaaatttcccatgttgttgagagtagcagcagtctcgaagcttgcgttgccaagcgtacttcgcctaatccgtaatgcacgctcat
ataagcggccaatttcagcccgctgtgccgctaattcctcctcgctatcaatgaacacacataagttagcaccgaccttatacacagataattctatctg
ttgcaaacttaccttcgttgttgtgtctccagttgatttgacagatacagggccaagttattcagcgattgagcaacttgcgggtggttttcaccaagtg
tcatctctcggatcttaagcgactgccgatacatagcagcaatgtcgggttgaggcacttcctctccttgtgatcctttacccacatccgtcttcgtgct
atcctggctaggacttgccatactttcgctgctggaactggatcggctaggactaggactagagccagaacgaacacctcggtgaccactacctccgtgc
cgtcctccactttttccccctctcgtgcgcagatctctaggctcttgggcatcttcccgctgtgctgcagacggtgaccgacgcttcccagcggttggat
agttcttgtaaaaattggccaggttgttcagacttgtagcatattccgggtggttcttgcttaacactcgacttcgcatctgaagtgctccttttagcaa
gcgctccgcgtgctgcagcagccagacattatgagctagatatccccagcgagtactgagacaaataccaaactggtttagcacttcagcgacttgcggg
tgttccgaccagcctaaaacctctcgttgtaatcgtaacgattccaggtagtggtattctgcagccacccagtctgtaacatcgcaacatgcgtagccca
gatccgtcaataataaagcttccagcgcgatgagctcgcggatacccacacatgtgcaccgatcataagctgcagacgcagcgatgggcggttgcggctc
ttcgaaagaaggcaacttgtccagtagcgatagctcacgatcaaactttgcctcttcgacatcccacagtagtgctgcagggtcattttctcgatggccg
caagtacaatgcagagagcgcgtctctcttgaaagttgtaagcacgacgataccacctgaatacgtcgtcgaggctccacacgcgctcggaaaatgaacc
gacaccgtaccaccaaattgctatacagtagagcatccacgatggaggaattattgagcgaagcaggtccagtaaaccttcgcccatcaccaccacttcc
gttgctactattgcttgtgattccagcaaagctactgctgtggcgctcaatatccggtttggctgcaataccatcgtcagtgaataaggatggctcgctc
ttcgacctcattgtactggcagaatcagcaggtgcttctccaagctgatcactaacgaggtcttgttgggcacgacgattattctcgcggacttgttcaa
tgctctgctgggtaagctcgtgagctaaccgcatagccgactcaatattagcgcgctccttgtcgaaaagcgccaatgtgccgtcaaaacgataggcatg
agatgccttagcaacgatcatacagtagtagcgcacaaaacgccgtttccacgtgagtagtagttctttacccagaggaatacttgtgggaggagctccc
attgatgcggcgacaaacgatgaaggtgtagagctcacacccgaaggtgttggatcagcaaggcactcctctcccatacgtccagcttcttcctccgcaa
aaagttgcacaagattgtgcatccgataacgattagcttttgagtcaaattccacaagcgaccactggtgaagtaattcaagagctacgcttgccggcgg
aacacttacttcacgagctttcacctcttcgctactctccagatcgagcagatcatagctgtcattggtcatagctccgtcgttgtcgaaaccaaagcca
tccatattcgaaagctgcgacccaagactacgaactgaggaagcgtcatcgtctctgttgcgacttcggctgctcttaggatatgcgtcagaaggaaaat
acgttgaacttgaagagcttgaccctgtcgttgttgctcctcctgacccgctcagagacgatgatagcaaggaatagttacttcccaccaattttccagc
agcattctgctccgtcaaaacgctcgaaagaactgcttcagcagcttcaatctcgaaactaccccgaaaaaaaccaaatgccataaaggccagccgcaat
ggctcatccaagtggcaaaaagatgaccggatgcagcggtcgacacactctttatgcccgacttgattgagctccctgatagtctcgaatctatggtcgt
cgcgctatagcaacaaagagaaaaggttagggttttcaacggtaacagttgataaagcttttcgcattacctccaagtactcgatcatacgctcaggagt
cacagtcattcgtgcattagcaagtgcacgcccaacaactcgaatagcaagaggaaggcaaccgcatattctggctaaacgctcggctagctttgcggaa
cagccaggtgcgacaagacacagtagctctgtctgcatcataaccaccgcacgagttaatcaaagtagagcattaagacacattatagcaggcacttact
gccgtatgtagcggaagttccgagattgaaagtgagtacggagtaacgctgggaatatgcatgttgcggcgagaggcaagcagcaacttcagattcggag
caacagaaataagctgatgcaagagttcttcgcccttgttttcatcttcatccagcagctcttccactttgtccagcacgagcaagcaatttttagtcct
gcatttcagacgtcacatttagcaagaattacagccagcgtagtttgccgaattagctcgaacaagttttgcgtactcaccctagctctgcaaatacttc
ttcgtcggtgtccgctgcaggcattccaatgctttgtgcgatggcataacgcacagtggagagtttctggccttccaagtctacgtaaaatacaccgtca
ggaaacattcgccgactgtgcacgaagtgcgcaacagagataataagagagctcttcccaatgcctggagcgcctaagcacgctgttacggcattctcgc
ggagcgatttgaccataagatacgtttccgtgttacggccaataaattggccatgcatggacggtatgttcgatgggtaccgcggcgagtaatcgcgtag
tttcccgtttggaatatcaccaaaaagcacaacatcgtgtgaggccgtacccaacaagagaaatttgctggactcatcgtgtggaaatgccaatgcatga
cccttgcaacaacattgagtggcactgtgttgggaatgtcgtgaaccatcccgcatccatgtacacgtcggctcatgaagatgactacagaggacaaaca
agcacagaatatcctattagtatagcacaagtcaaccaaaaaaatatcgtaaagctcacgcgcaacaacaagcagctctcttctgagtaggaagtgcccg
tactgcacccttcgcgatctcgaacgccgtcgacactgtatggccatggaagagtgataaataaaaatgttttgcaaacattgtggcagatgcgtcgacg
accaaagagtccgaatgtaccgcgacgacgtgcggaattccagcattcaggaacacagacgccaccttctgactatgacaggcattgacaaacacaagct
gcacgttgccatccagcggctttggaccagcaactcccacctccgccgtcttcatctccactggtgtcgctcctgctacctgctgttgttttcgatcgcc
tgagaacatcagctgcctcagtgcgtccggagtaatgagatgtgtacaacctgcgccatcctcgaagcagagagctgcacgttgacccagtccatgacct
gagaagtggagcactgtgcacttccaagccgtcatgaggctgcgtaggatatcggcactagcaatatcgaagcgcacgtggatggccttatgttgcacat
ctgtgagcagcgagttgctgatctctcggcgctctgcttccagatccagcttctccatggggtaaatgcggtggcgactgtctttgatcacgagtggagc
cgcatgaagcaccacgaggtccagcgcattgtcgtcgcgaggcaaccaggcctgattaagttgctgggaagttgccgatgttgaagttgctggtgacgtt
gacgttgatgcgtcaccaggtgaagacgcaatcaacgtctcgatggcctgtgcaatccgcacgcggtctccgaatgcagcaatgcccagatcatcgcgca
gtgcgttgcgtgtgagctctggcaggatggatcccgagatcttgttggcagcgaagagctcctcgtgctcgccgaagccctgcgcacgtagccagcgccc
tacatcggcgcaggaccaggcactccatggcccgccctccattttgaagtgaaagtgaggcagtcactagctcatgaaatgtacctatatgttgatcaag
tgaaacgtatcataaagattacgttattagtctcagaacctgatgacatgatactcagatctgatcccaattgtttgaatttgaccatccattcgtgatg
gaaacttcggctggtgctaagaagcggccgcgcgccgacttgctgtcttcgctggacgcggcctttgcgtccactgcacagcctgccgtttccaagtaca
ccgcacaggctgcagcacaagcggcgccgaagggcaataaacagcaggcctaccagcactcgaaacgcaagcacaaggacaagaagcgtggcaatggaca
aggaaacggacaggatacaggaaagcaagctgataaggcagacgagaagaaggctgtgaagatcgatccgttgtacgagaagatgggcgtaaatctactg
gccgttggactcaaagactgctctttggtgaggggcgccgaatgggaaagatatatacatcaatactggtactgacactattatttgttagcaaccacaa
gcggagatgttaatgaagccacgtgctttgcatgagacgttcaagaattatctggagtccgtgacacaaggcatgaagacaggggcgagtgctgtggatg
gtctcaagaacaaggtgttgtccttggataatccgtttaagactactgctgctgaaacggcggagaaaacaattgcagcagctagtagaaaacagacggc
caagttgctgagtgcacgtcgacgtagagaactgggcttgcacatgcttggtggagagatgaagtatagcgacgcagagcagctcaacgacatttggacg
cgatacgtcagccaagtgattgagagcgaggtcagtgacgttcagcaagttaccgaggagggccagcgtaggcgcaacgcaaagcttcaggctaagctga
agtacatggatctatcgggatgtccgcttgaaggtatgctgcgtgctgttcatccttcatttgtgcaatcattgctaacttgtcgttctctgttgtcgta
ctgcagtggttcaatcgttaaatccatgcaacgtgggcctcagtgggatcgttttagcggagactcggcaaactttgcaaatctgctgccctgcttcgtc
gagcgatggcaatagcgagggatctattcgcagtacgtacttgtgcttgatgcttgaattatttgattcgcttacatatcttggtaattattgtagcgct
aaagaaattggagtcgcagtttaaggttcgtctctcttcgactcgtagcttggctttctgaacgagcccagtagacaaaatttttttcaatatagagctt
acagcaattttacttgtgcacaaaatttgtgcatgcacatttacaaaaagttcgtttcgttatgtagataatgaggggttatcgtcccttccacagactt
tctaagcatcgatcgatttctaaaacgtgggtacaaggggtacagtgtacaacaggaagtccatgagctgtagcatcgcacggctactgctgctgggcgt
ggctttccatgtgctgtgcatcttcagtgtattcgacatctacttccagtcatccgttgagtcttccatccgcagtgccaattttacgtcgtcgcctccc
gccaaacgcgtcgtcattttcactctggacggttgtcgcgttgacaagctcttcaaagtcgtcgccggccatgcagaccactacgacctcaacccaagca
gtaccgaggctgcccaattcaactctgacagtcgcgttccgttcctgggtcaggtgatgagaacaaaaggcagttggggggtctcacacaaccacgcgcc
gactgaaagtagaccgtgccacgtggctctgaccgcaggaatgtacgaggacccgcacgctgtttacaagcgctggaaacaacacccagttccctttgat
tctgtgtttaatcagagcaacaatgcctttatctttggaaataaagatgtagccccgatattggctgctcacgctccacaggccgtagaagagcactata
ctggacgagaagaggtcgaaatggctcgagaagacacgacgttgttggatgtttgggcctatcggaagatgaaggagttgtttgcaaggggaaagaaagc
gagggatccggaattgtacgaaaagctgcatgatgataagttggtgatttattgtcattttctaggcaccgacttgacggggccgaaatttggagcagat
tcgagggagtacttggagaatatcgcagtggttgatgatttga