Description :
From Genome Similarity Track
Location :
Scaffold_320:4730- 10323
Sequence
5593 bases(100 bases per row)
TGCGTGGGTACAGATGCACAGCGTGCTTGTTTCGCCAACTTGCCCTGGTATTATCGGATCGTCGTCACTTCTGGAGTTAGGTACCTCTCCCAGAGACCAT
CCCGTTCGGCGATGTAGACAGACAGCGTATCCTCAATTCCGGTGAGCCAATTGGTAAAAGGCTACTGGGCCAACTTCCACAGGATATTATCGACGCCCAT
CGGATTTTTTTTATCGGTGTGAGACTTGGACACTGATGGTTTCTCCGAAATAGACCTCTAGCTCTTTCGTTGCATCGACATACTGCTGTTGTTGCTCAAT
AAGCCAATTGGTTTGATGCTTTTCTCCTCAAGGGTACTCGATGCACGATACTTTGTTAGCGCATTCGCTATAATTCGGTCCGGGAAGGGTTGGGCGCTAA
AACAGAGATAAAACGTCTTGTTACTAGCTTAAACATACGCTTAAGGGAGCCTGGGTATCCAGTAAACATAAGTCTGATGTTTTTTTAATTCGTACTAATA
ACGATGATTTTTTATCGTTTTAAGTACGACCGTGTCCCTGCCTCTAGGGAACCACTCGTTTTCAGCTTAATTTATCATTGGTCTATTTTGGGTCTTTAGG
CCCCGATAATGAACCGATAATAAATTGCAGGTGGTGTGCCCGCTATTCGGGCACACCACCTGCCTACAAATGCAATTGTTTATTTAATTGTGTTAATCTT
GTATGTAGCCCGTAACATCAACCCCTGCTAAAAAGAGCACTCCCCAACCGTGAGTGCCCAACTGTCACACCCTTAACAGTCACGACCGAATCAAGCGATG
AAGGAGCACATGACCTCTAAATCTGCAGCACTTTTACGCACCATCAGCAAGCGCTCAACGACCCACGTGATGGATCAACAAGTCAACCCTATGCGCCATA
CAACGCCGGAATTTGCGCTCAGGAATCACTTGAACCAATGCAGAAAAATTCCGGCGTTTCCGCTAATCGCGCGGAATGAGTGTTGAGGGCATTAAGTAGG
ATGCTTTGCAAAGTTCCTGGTGCACATTCAATCGGCGATGGAACTGGATGATCGAGGATGAAAGGAGCTTTCTACAGTGGCTTGCCAAACGAGAAGACGT
TCGCGCCGATTATCCAATTGGCGCATTACATATAAAACCAGCACGCTTCGACGGAAAATCGAATCAGCTATAGAGATATCAATGAAAAAACGTTGCTTTT
CCGGCTCGATGTCACTTCCATCTTGCGACGAATAGCAACGATACATCGTTGAGTGTCTACTCAGCTAACGCGAACAACCTGGATCGGAAGGTACGAGCGC
AGTCTGTACGAACGGCGGACTGCGGTTACTCGTGGTGCACCTTGCTGGCGTCATCTCGCTCGGCAGCAGAGTCAATCCCCGCTGAATAACCAGAGAGGGG
TGGCAACACGTTAATCTGCACGTCTTCTTGCGTGCTTCTCTTCGAGTTTCCGTTCTCGTTATCGTGGTTATACACATTCACCACGCTCTTCTCGTTCTCG
CCATCGCTCTCATTCTCGAAGGCGTGAAACTCTACACAGTTCTTTTTATCGACGTTATAAGTCGCCGTCACGTTCTCGTTCTCCACAAGAACATTCTATT
CTTTGGTCGCATCGGGGTGGACCGACTCCATTGATTCATACGCCTACACTATGTCTCTAACATTGCGCAGAAGCAAGGAACGCGGCTAGGACATACCTGT
TCGGGTGGGAATCCTAGCAAGCGTATAAGATACTTGCGCGCGGATAGAACAGCGCGCGTATCATGAGCCGACAATTTGTTTTCACGGGAGGGTCCTTGTG
ACCCAAAACACGATCCACTATCAAGCGAACCTGTCCATCCGCTTTCACAAACGGTAAGAGGCCGTCATGAAGGTAATGTAGGAGTCCTGGTTGCACAGGA
TGATGTTGATGAGGCTTTAAACAAGGTTACCAATGATCAGCAAGAAGCTGAGGCTGCCCTCGAGCGTTATTCACAGGCGGAGAGAACCGCGAGTGGGATA
CGGCAGTCGAACCGCGAATTTATAAAAGGAAGAGAAACCTATGACGCTAGGTTCTAGGTCATGCGCGGCGGGAATGCGCCGTGTCCAATGTCATCGGTTT
GCCAGGCGAGGTATAAAGGGAGTTCGATTTACGAGATGTTGATTCCGGTATGCTAACAAACCCGTGAAGCGTAGCCCGGCCATACTCTTTTAGCCGCTCT
TCGTAGAACATCGGATAAATTCGCAACGATGAGGGAATGTATAGGGTATAGGCGTCACCGATTACCTAAAGGACCCTGAATGGACCGAGGAAGCGTGGAG
CGAGTTTATTTGCGTGTAGGTTGGTACCTGCTAAATCCATTAGACCTTCCGTTAATTTATAATACACGATCACCTTTGTTAAACTTACTCATGTTTTTCT
GCCTTTTTTGTCTTCATTCGCTTTCTGTTGATCCACCCCAAACTGAAAGCGAATGAAGACGAAAAAGGCCATCACGTACAATTTGGGTGATGGCTTGACG
TTGGAGGATAAACTCTGACACAGCCATGTCATCAATTGGTGGCGCCAACTCAATCGGCGCGTAGTTGGCAGTAGGCGATTCGTACCCAAAGACGGGTCAA
TTCGTCTCTGCGAAGTCCATCGACATAAAGGGGACGCCACACCACGGGGCGTCAAACAGCAGACTTCGCCATGAATCGGGTGACTAAGGCTCAAGTAATT
TGAGCTGCACGTTTGTTGTATATCACCTTCACCCCTCCAGGCGGGAGCCACGAGGTGCTGTGAGGTGGCCCACGGAAGAAAGGTAGGAACTTGAGGGTGT
CGAGCCAAATTCACCAAAAATGGAGTCAACCTTGTTATCGCGTGTACAGGATTGTTATGTGCGAACTCATCAAGTGGTAAGAATGCACTTAAACTCGTGA
AGGAAGTAGCATAAATTCGAAGAACATCTTCGAGGACTCGGTTTACATGCCAGATTTGTCCATCTGATTCCAAACAGGCCGCGGTCGACATCTGCTGCTT
CGTCCCGAGATCCTCAAACAGTGACGTCCAAAATGCAGATGTAAATTTAGGATCACGGGTCCGAACTAGTATTTTTCGGCAAGCCGTGATGGCCAAACGC
AGCGTCAATGAAGTACACCGCGGTCTCTGCGGCGGTAATCGTTGCGTGAATAGGCACAGGTGTGTCATCTTGCCAGATCTTTCGAAATAGACCTAAGAGG
ATGGACCTAAATAAATTGGATGCAAGGGACCAAGGTTCCAGGATGAGGCTATGGTGACACTCGGTATTGAGATATCGAGGGCCACTTGGGGTCAGCGTTC
TGAAGAACTTCCACCAAGTCGAACGGATACGACCCCTATTAACGGTCGTAAAACCAATATAAACTAAAGCGAGTTCGAGGGTTGTGCCCAAAGAAAGACT
TAGGAGTATGTCGAGTCCGCATATTCCGTCAATCATTCCTTTCAAGATCAAGTTTATCACGTCTCTCCACGCCCGAGTTGCCCGACTTTACGCTTCTTTC
GCGCGTTGCAGTATGAAGCGAGGTAGATCTTCGTACGCGCTTGGTCTTTGGATATTCGCAACCAGTGAGTATCCCTCCAAAGCGCTTGGATGTGTTCTTC
GTCAAAGCGAGTGTAGGCTGCAGCCAAACCCGGCAAACCATCACACCGGTCGAAAGGATACGGACGGAAGCGGTGCTCTGGCGGAAAACCACGTGGAAGT
GTTAAAAAGGTTCTTGAGCATGGTGGAGTTGATTGGAGATTTTTTCACACTGGTTGGAGGTAGAAGCTACCGTATGGTGGGCCGGACCACCTTCACGTCA
ACTCCAGACGATCGAGCAGATCGCTGTAGCTCATTTTAGCGACGCATTAGAAGTTGATCAAGTCGACTGACTGGCCAAGGCACCACTTTCACGGAAGCGA
AGGTATTAACCTTCGTTTACCCAGGGATGATGACATCCGTTGGATGCAAGTTGGGGTCGTTTGAAGCTGACTTTTCCCCCACAACCGTACAAGCAACCGT
GTTCCCAGAGGCTGACTTAGCCTCCGAGTCGGAAGACCCGACAATAAATCCAGATAAAGAGCGGTCTGTGGTTAAGGTCGATCCTGCAGAAGTGGCGACA
GGAAGCGGAGGTAACGAGGGACCTTGGACGCAAAAGGTTGACCAGAAGACCACGACTTGTCTAGAGATTCCCGGACGACCTCACTATCGGTGCTTGGGTC
ATCGTCGGGGGAGCACCGCAGAGTTAACGCAGAAGTGCCACCAAAAGATCCTGACTCGATCTCCGACAAATAGGAGCTTGAATAACTTGCGCAATTCGAA
TGAGCTTAGCGAACTCTCTCGCCGCGGTTGCTTACCGGAGACGAGAGAGTAAGGATGGCCTCCTGAGACAGGATCCTTCGAGGAGCCGGTGGCTACGGTC
GGCCCCGATTTTGGAACAGCAGCTGCGATGAGACCATTGGAGAAAGAATCGGGACCGTGAGGGGCCAAACGAGAAGCCAGCATAATTTAACTTCTCCGCG
ACGAGGGAATTTCGACTCGGACGCTAGTCGACCTGACACCGCAAATGATCGACCAACGCCCTCTCGTGTTGAAGACCTTCACGGATATTGACCACGAGAC
TGGAGCTGTCACGTATTTCTCCTTCAGAGCGCACACATATGGCCATATAATAGGCATTGGAAAGGAGTTATACGGCTAGTCGGCCTTCGTAATCCCCAAC
ACGGCGGGACTGCGCAGCCATGTAAGTCTGCAGGTAGTAGAGAGATTGACTTATACCATTGACCGGGTCGGTCAGCGTTGACGTACAACCTGAGATGTAG
ACCAGCGTGGTAAATATATCGTCGACTTGGTCATGCGACGTAGAAACGGCATCAGGACGTCATCCAGCTTGGTGAAGGTAATATCGACCGAGTCGGCCAA
CACTAGAAAGGCATCAGCGGTGTCGGTCGAGCCGGAAGACGGGTCATCGACTGCTTCAATGTGTAAGGGGCACCAGGTGTTGGTAGACGCGGCGGGTGAA
TCTTTGACTGGGATGACCGTGGTCGGAGTCTCCAGAGATAGACCGGGCCCGGATGAAGGTATTTCTGGAGCAACATAAATGTTACGAGGGCCACCCGATA
CCGATTAAGGACAAGAACGCACAAGATTCACGTGGTGAAGACATGCGCGTAATAAAACAGCTGTACGGTTAAGCGATTGCAGGGAGGGGCTGTGGTAAAC
CGGTTTTTATAACGTAAAGGACCTAGGGTCAAGTGAATCAAAGGTAACGGAGAGAAATGGACCAAGGCGAGAACACAACATTGGGACGAGAAGACTTTGC
ACGACCTACAAGGAAAGGATTACCAGAATAACGGTTAAGCGGTACTGACGGAAATCGACCACGTTCCTTCATTGGAAAGTCTGATCGCTGAATGTTGACC
CGAGTTCTCCAGGGTCGACCCCAGCCCCTCATCGGCAGACCTAATCCCTCATTGGTAGACCAAGCTCCCTCATCGGTGGACATGTTCCCTCACCAAAAGA
CCTGGTCCCTCATCGGAAGCCAAAGGTCCCTCAAGGTTGGCTACTCCTAGACAGTCAAAACAATAAGTTAGGGCAGGTATGGACAGAGTAAAG