Description :
From Genome Similarity Track
Location :
Scaffold_42:4730- 5853
Sequence
1123 bases(100 bases per row)
TGGCTTTCCAGTAGCAATTGTCTCTGATAGAGATCCCCGTTTCACTAGGAAGTTTTGGAAATCCGTCTTCAAGGTGCTCGGCACCTGTTTGGACATGTCC
ACAGCGGATCATCCGCACATTGATGGTCAAACTGAGCGTGTTGATCGCGTCATTCATTAATGACATTTTACGCAGTGTTTGCGCTGATACGCCTATGCAT
TGGAGCTCCATGCTCCCTGTTGTTGAACAACGCTGTTCATGCCTCGACAGGCTATACTCCGTTCTACGTAATTGGTCTCACCCACCCCCGCGTTCCGTTA
ACGCTACCACTATGTGGTTCAGGGCTTGGTGGGGGAGAGGTTGCCGATCGGCTTGCTGATATCAGCCCTGCTACTGTTCAAAAACAGGTAGGCGAGTTTC
TCGCAACACGATTGAATGTCTTAAGACATGTGCGTGACGCAGTGGCTGAAAGCCAAGACCAACAAAGACAACAAGCAGATGCTAAAAACAGAGGTTGTAT
TGAATGTTATCAGGTCGGAGACCAAGTATTACTCAATGATAAAAACCTACCATCAAATGTAGTGTTCGCTGTCTTCAAGACAAAGTTGCGTCTGCGCTTC
ATTGGACCATTCACGGTCGTTGCTAAGAAGGGACTTGCGTATACGCTCAACCTTCCACGCAAATTGCGCACACATCCTGTGTTTTACGTGGGCTTGCTTA
GCCGTATCGGGATCCGTCCCACGTGAACTTGGAGACGCTTGCGTCGCGGAAGTTGGCCTTGCCATCGGTTGCTGCATCCGAATCAGGAGGTCAAGCTGGG
CCTCCATCCGGGTGACCCGACTCCAATGCCTGAACGCAAGCTTGCGTCGCGTCGAGCGCACTCTGGGTCTTACCCAATGTCTCACGGAGACCATTCAGCT
CGAGAAGTACCTTCTCATGCTCCTCCTTCGGTCCACCGACCCCCACCGACGCTGCTCGATAAGAATGGGAACCGCCAGTTCTACGTGAAGAGATTCCTGA
AACGACGTCGTCGCCATGGCCAATACCAATACCTGGTAAAGTGGCGAGGGTACCCAGAGTCGGAGAACTCATGGGAATATGAGGTTCCCCTTCGGCAAGA
CTGCCCATACGCCGTGGAGGTTT