Description :
From Genome Similarity Track
Location :
Scaffold_413:473- 7712
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_413-fgenesh-gene-0.0Ankyrin repeat-rich vertebrate

Sequence
7239 bases(100 bases per row)
CAGATCGTACGCGAGACCATGCCGGCGGTGGATCCGGCGGCGCCGCGCACGCCGCGTCCGTGGGACTGGGTCTGCTCGACGCTGGTGAACAAGGACAAGG
GCGAGGTACGCCATTCTCTGGCCGACGAATAGAGATGGGCAGTGTTAGCTGATCGTTATGTTCTAGTGTGCCGTAGAGATCCTTGACACGGTCTTTGTGC
AGCGCGAGCAGATCTGGTCGTGGTTCTACAGCAGCAGCGGCGGCGTCATCCGCAAGAAGGCGCAGCGCAAGCTCACAGCCGCCAACGTACTGCAGCGCTT
CAGTAGTATCGCGACCAGCTACGAGCAGAACGTGGCGGGCTTTTTGGCACTGTGCTGGTTCGAGGACCAGCGACGGCTGCAGCTTTTCACGGCGTCAGAC
TGCCAGACGTATCTCGCGAGCTGCAAGGGCAATGCCTGCTTGAGCGCGTTTGCCCACCCGCGCGGCGAGCTCGACCCAGCACGCTACGCCAATCTGGAGC
ATGAGTACACGTATGTAAGCCGTCTGAGTTATAGGACCCGTGGTGGTGAATGCTGATGTATTGCTCCCGAGTTAATACAGACTCCACAAGAGCGGGAGGC
TTCAGGGCAAGCTGTATCGCCACGCGCTGGGGAACCAACGGATCCTGAGTATGGACCACCAGCTCAATAATACTATCGGCGACATGGTGCAGGCCCTCAT
CAGGTGAGCACAAGAGGAGAGCAAATGTTAAGGAGGAAAAGGATGTGATCTCATCTACTGTGTCGCTCTCCCCCTTTCAGTTTTATTGAAAAGACCAAGA
AATGCCGCGTCGTGCATTGCAATGCACACTTTGTGATGGACGCCTTTGGTCGCGCCATGCTGTGGCGAACGGACGGCTTTCAGACCATTTCGCTTCCAAG
CTGTAACGTTGTCAGTGGAGCACCGGCGTACCAGGGCCCACACGCAGTCACGGAGCGAGTACTCGCTCGAGCCAGGGCCGACGCCTCCAAGCAACCGGAT
GAAGAACTCATTCAGGCCATTTTATCGTCGCCAACGCCAGTCTCGAGACGACAGACCATGCTTCTTCAGACGTCGGCCTCCCAGCCGTCCTTGCCCTCTC
CTGCATCCGAGTTCAATCCATTTGCAGACGACGAAGTGTTGAATCGACGCGGGTCGATACAGTCTCGAAGCCAGCTCCGCAGCAAATCCGACTGGGACGA
GGCCATGCAATTTCTGCCCACGAGCTCCTCTCTCTCACGTGGGCGAAAGCGAACACTGTCGGCCGCACATCTCGTGTCGAGCCAAAAGCGAGGCTGCTGC
GGAGACCATTGCGACACGGATGTTCGGAAGTGGACTTCGAAACGGCTTGGCTTCAAGATGAACCTAGCGGCGGGTCCAATCGGCAGTCNNNNNNNNNNNN
NNNNNNCGACGTGATGAGAAAAGGGATTGGAGTTGGCCGCAGCAGCAGCGTGATCAGCGCGACCACGGCTGCCAGCGCTTTTATGACGGCTCACCCCGAC
AATTCTTTGATTGACGATTCCCTGACCAGGAAGCCCATGTCCCCTCAACGGCAGCAAATGGAACAAGGAGCAAATGACGGGGCGATGGGTGAGCAGACAC
CGCATACCATCCCGTTCAAGCTAATCGCACAGACTCGAGCTGAGAAACAGCTCGTCGATTTGTTCATACGACGATATCAAAAGGGCGAAGACGGCGACTA
CCTCGCTGAGATGTACTATGGCGATGGTGATCCACTCGGGCAGACATTTCCAGGGTACTACTACCAAGAGGTCCAAGTGTGTGCGAACTGCTTTGCATTT
TATACGCTCGTGGAAGACGTGCGTATGAAGGCATTGCGTCAGCTCGAGCGGAGGCGTTCGTCCACCAATAAGGACCAGAGGAAACGTGGTGGTCGACAAG
CGGGCGCACGGGACCTTGAGCCGCTCCATGAAGATCGCGAAGACATCGAGGGAGATGAACTGCAGCTACTCGAACTGGCGGTTGCCGCGAGGGGGCTGTA
CAAGCATGCCTGGGTGTTCGCTCGGACAGTGTGCGTGCCAGCGATCTCGAAGAAAGATGCCGCTGAACTGTTCAGTTTCGTCAACCCGCATCCGGCAGTC
GCCATGGTGATCCACGCATTGGGAACTCTTCTCCTCGGCCGTGATGATGCGACTCCATCCGATTTCAAGCGCGCCATGTCCCAAGATAAACTCCTTCTAC
AGCTGCAGCAACTCGACGTGGAGCATTTGTCGCACGCGAACGTGGAGATCGCGGCAGCGCATGCTCGGAATCCGCTATTCTCACCCGAACGCATTGGGCC
CATCAGCTCATGTGCTGGTCGATTCTGTGACTGGTCTGTGATGACTACCTTGTCTGGCTCTTACCCTTCGTCTAACCACTGTTTTGTTTCACGTAGGATA
CTAACCGTGCTGCAAGCGTACGCATGGAAAAAGTACCCGGCGTTTCGCGACGATCCAGACACGTGGGAATTACTGGCATATCTGAAACCCGATCTCGCGG
CCTCGAAAATCCCACGGCAGGTTTTCCTCGATGGTTTCTTCGGGTCACCGAGTTATGGTGGATCAACGCGACCAAGCCACAAACAACTGGCGGGATCAGA
TTCGACAGCCAAGAAGAAGTCCACCGCTGCCGCCATCGCGCGACGTGCGATTCAAAACGAACAAATGGCACGACTGGCGGCTCCTTCGGGCGTCGTGGAG
GCGACAACACTCGGTGGCAACGACATGGCTTTCGTTTGCGCCGACGGCGTCACCAAAATCCCGTACGCGGTTACCGGTCATGCTGCCGCGGGCAGTACCA
AGTGTAATTTGATTGTGTTTCACGACTTTTTCGACACAATGGAAAGTACGAAGGTTTTCTTCCGACCGATTGTCGCTAAGCACGTCGGCGCTCGCGCACT
CTTCTTCAACTTGCCGGGGCAAGCCGGCTCGCAGTATTCTCACGAACAGGACAACCCTGCCGTGTTGAACAATGAGTGGTACGCGCACAAAGTGCACGAG
TTGCTTCAACATCTCCAATCGTCCTCGAGATTTCTCACGACGGGTGTCCCCTTCCACCTCGTCGGCTTTGGCAACGGCGCCAACATTGCGACGAGTTTCG
CCATTGCCTACGGCAAGCTCAACTGCTACATAGACGATCTCCAGTCGTTGGTCCTCCTCAATGGGTTCGCACGCGTGGATGCACAACTCGCGGGTATTTT
GCATAGCACGGTCAACGTCTTCTCGTGTTTTCCTCCGGCACGGCCCGATCTTCCGGTGACTTTCTTTTGCAAGTATCTGTTTTCCGAAGCCTATTTGTCC
AAGATCGACGTCAACCTCGCGCTCAGCATATACACGGCCGTGACCAATCCAATAACGCTCGACGGACGCATCCGGATATGTCAAGGAGCGTTGCAGCACG
TGGATTTAACCCGCGACCTGCCGCAGATTGCGGTGCCGCTTGTGCTGGTTCAGTCGGTGGAGAACGTGCTCGTCGCACCCACAAGCATCGACCCGTTCCT
TCAGCAGCGCGTCCATATCGCGCATTCCTGGTCACATCAGCAGCAGCAACCACAATCGTCGGGTTCTGTGACAGCAGAGCCGCTGGTACCCACCAAGACC
AAGAGGCAACTGCATCAGGTACTGGCGACACCCGGTAGCGTTTTCGTCTCGTGGCTCCGAGCTGGCCACGAACTTCGCCAGGAGGCCAAGCACTATGTGA
TCGAACTACTCGAGCTCGTAGTGTGCTCGAAGGAAGCGAACGCAATACATCGGCATGGTGTCACGCACCCGTTGCCGATGGAACACGTCTCCTCCCCAGC
CAAAATAGACAAAAGGAGCTCTGGCCAACAGGGCCAAGCGAGTGCAGTTAGTTTGTCGGCTTGCAAACAGGCGGCTGCCACGCCAACGTCCAAGGTCTCG
ATTCCAACTAGAGCGACACCACCACCGCGCTTCGATCTCGTGGATTGTGACCAGAAATCCACGGTAATCCCAGACAGCCCAGCCGATCGTGCTGGTTCGT
TGGTTGGAAAGAGAGAAGTCGGTCTGTCTGCAGTTGTCTCGAGCCCAAATCGCCGAGAGAGCAACCCAGACAGTACGCAACAAACTTCGATTCGCGAGAA
ACCACCAAGGCATTCGGCACTCGGAGAAGCAGTTGCTCCTCGACAGCCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACCACCAACA
GCATGAAAACAATCGGTGAGTCTACCGCAGTTGCTGTGGCTCGTGAACCTGAACCGACTAGCTTCGGGGACCTGATCACACCGTCGCTACCGCCTCGCGT
TGACAAGCCACTGCTGCCAAGCGCGTCATACGACAACGCTCACCAAGACTATAACAATACAGTAGACTCGGAGATCGAGGCAGTGCGCATGCGAATAGAC
GCGGAAGAAAAGCGGCTTCAAAAGGAGGCAGAAGCCCTTCGTGAGCGCCAGCGGATCGCCACAGAACAACGGATGGAAGCGTTACAACGCGAGCAAGACC
GCCGACGACGGCAGTGGGAAGAAGAAGACCACGCGCGTCTTGCGGCTCTCCAACAACAGATTCGCGATGAACAGCACGTACGAGACGATGCGCGGAAACA
GCGCGAGCATGAGCTGCTTCATGCCGACGTCGCGACCATCGCCAGTGATATTCCGTCCACTATCACTCCGCCATCGGCTCTCATTCTCCCATCCCCACAG
AAACAATCGGACGATCTCGTGGCCTCGGGCCTCTCTGCGATGAAACAAGCCATTCGCGCGCAACCGGAACTGCCCAGTTTGTTTGATCAGATGGAAGCCG
AAGAAAGAGCCACGAAGCGAGTCGGCAAAATGCGCGTGGACGATTTCAATGCTGTGAAGAATGACATGACCCAGAACTTTTCTCACCACGTAAAGGAACA
TGAGAGCAGCCTACGGCAAGAACTACTGCGCCGGAAGTATTCGCACGCGGTCCGGATCCAAAAGCATGTGCGACGCTTCTTGGCGGTGCGGAGAGTGGCA
ACGATCCGCCAGGAACAGCAAGCCGCCCGAATTCGGCGATTCGCCGGTGGAGAGATTGTGCGCATTGTGCGAGGCTTCCTTGGGCGCCGTCGATTTCAGC
ACTATCGAAGAAAGTGCGTACGTGAGGCTCATGAGCGTGCATCAGCCCTGGCGATCCAACGACTGTTTCGAGGTTTTCTGTGCCGCGTGAAGTTCCGCCG
TCTACTAAGAAACAAAAAGGCCATCGTGGTGCAACGCGTCTACCGAGGGCACATGGGCCGATTGTACTGTGAGGAGCTGCGTGAGGCACTGATGCAACGG
CAGTTCCAGGACCGGAATGCGGCCAAACTGCAAGCGACGTGGCGTATGCACGTCGCGCACCACAGCTTTCTCACGCAACGCATCTCGATCCTAGCGGCCA
ATGAGATTCAGCGCGTCTACCGCGGCCATCGTGGACGCGTCGAAGCCAAACGCAAGAACGCGTGGCGCAAGGCCGAACCAGGGCCCGAGCGACTGGCGCT
CGGGCTCAAAATGATTGAAGGATCCAAGCAGGCGTTTGAGCGGCAGCAGCACGAGATCGACGCGCTCCACCGCGCACAAGAAAGTGTCGAAAGACAAGTC
AGCACGATTCACGCGGAGCTGCAGGATTCCGAAAAGGAGCTGGCCATCTTGGAGCGAGAGCTACAAGAAATAGATCAGCTGGAAGCCGACCTACGCGAGC
TCACCCATGAGGCCGAGATGCTCCACAACGGAGGTCTCGAGGGGATTCTTCGAAGTACCAGTTCGTCGGCTTCAAAGGCCGTAGCCGCACAGCCATTGGG
TAATGGGATTCCCACTCTCGTTGCGTCGACTGCGTTCCCGTCCTACGAAAAGGGAATCGAAGACCTGTTTGAAGGTCGGAGTGACATGAAGAAGCGCCAA
GCCGATGCGTACGCCGTCGAGATGGCGATCCAAATCAAGCGCGCCGAGCGAGAAAAGAAGAAGAAGGACCTGGAAGCCGAGTTCACTAGCGTGTTTGCCG
AGGTCCAACAGAAGCGCCAGTCGCTTCGGGAAATGGAAGAGAAGCTTGCCGACATGGAGGCGACCCGCATGCGCAAGGACCGCGAGTTCGCGCGCATGCA
GCGCAACCTGATGGAGCTGCTCGAAGAGCAAAAGCTCGAGCTCGAGAACCTTCGTGAGAAAGGCATTGAACTGGAGACCGCGACGGCGACGTCAGCAGCG
GCAGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAGGCCAAGGAGCACGAGAAGCGTTCGCAGGCCATGTTCGA
GTCCACAGAAGAACTTATGAAGTTTCAGTTCATGTCTATGTCGCTGTCATACTTCAGCTCGCTCAATATGCTCAAGAACTTGCGGGACATCAACGCCGAC
ACGACGGCTTCGGCTATCACGTCGACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCCAACGATGAAGCGTCTCCAGGTCGGTGGCTCGGATTTGA
TGTTGGCGGCGTCACAGCTCAAGAAGACTGAGCTCGAGAAGAAGCGCAAGGAGGAAGAAGACGCCAAGCAACCCAGTCAACAGCAGCCCATGCCCGATCA
AGTTCAGGACTGGACCGTGGACGACGTCGGGCGTTGGCTCGACACATTGTCACTCTCTATGTACAAGAAGGCGTTTCAAGAGGGCGCCGTGGACGGCGCG
TTCTTGCTCGAGTTGCGACCCGAGGACATGGCGGACGTGCTGGGCGTATCCCACAAGCTCCACGTGCGCAAGATCATGGTCGCACGCAACAAGCTGCTGC
CGCTCTCGCAACAGGAACAGCTCCAGATCGATGCCGTGAACCACGAAGAGCAGGCTCGAAATGCCCGCCAGGGTCCCAGTAGCTCGACACCATTGGACCT
CGAGACAGTCTTTTCGCAGGCTCGGAACGGCCGCATGAAGCGGCTCGTCGAGAGTATCGACGCCGGCTTTGACATCAATGCCGAAGACGACAAGGGCAAC
ACGCTGCTGCTCATCGCGTGCCAAAACGTCAACATTAAGATGGTCGAGTACCTCGTGGCCAAGCGCGCGAGCGTCAACCACAAGAACGCACAGGGCAACA
CGCCGCTCCATTTCGCCATGGCCTACGACACGGAGGGCAAGCTCGGCGAGTACCTCATCGCTCACGGCGCCGACGACACGATCGAGAACTCGTTTGGGCT
CACGGCGTACGACGGGCTGCAGCCAGAGTAAACCGGATA