Description :
From Genome Similarity Track
Location :
scaffold_287:473- 1907
Transcript NameFunction/comments
Plaha_PHALS_03266hypothetical protein

Sequence
1434 bases(100 bases per row)
CTTGAACTCGGAAGTTTCTCCTGAACACAAAATAGTTTTCCTACTATAGACGAGAATTGACCTTGCAGAGCTTTGCTGCGAAAGGCACACCCGATCTCCG
AAATATTGAATTATTCCCGGACTACACGTTGATGATCGATCGATTACACAGACGTAGAGTCAAAGGATCATTTTTACAGTTTCCGTAGATAGAAGAGTTT
GGCACAATATAAATCTTGTACCAGACGCAATGTGTCGTGTCACGAGGTGATGCCGTCTATCACGGCCTTCTTCGCCGAAATATTGATAGAGCGTAAACAT
TCAATCTGCACTCATCGTTAGCCTCCTGGTATCGAAAAGCAAGCGGATTTTGGCGACTAGCTCGTACTGTTATAAAACAGAAGAGTGCCAACGTGCCGAT
ACAGACCTTGCGCTCCAGGAAGGGTGCATCAAATAATGCTCATGTCCGAATGCACGATATAAAGTGCACATGATCTGGTGGTGGAAAACTGTCAAATTCT
TATGCAGTTATTTATTATCTTATTTACAGCAGTGCAACCCAAGCGAAATACAATTTGTGTGGCTAGTTGTGCCGCAGAATCATTCCAACTCACTAACGAC
ATATAATCATACGGTAACACAGTTGTTTAGATCCCTACATATACGTTTGCAAAAATGCTCTTTGACGCTTTAATTGACCAAAGTCTAGCTAGAGGTAAAA
AGCTTGCTGTCGACGCGCACTTAAGTACTTCTGTCACACGATTGAGGTCATGAAAGCAAACAGGTTTTTTGCCAGCGTTGAAAAGTGTATCCAGATTAGA
AGTCTTGGTTGCTTCAGAGCAACAACGGTATTTGTGTCCCTTATAAGGTTAGTGCCATTTGCGCATCGCGATCACCCCTATCCCAAATCGACCTTCGTAA
GTGGTAAGGATACGCTACCCTCCTGTAAAATATCAGCTCGAGGGTTCATGCAGAGATTGCGAGCGCCTGTCAGACTTGTTGAAAGATGAATGTGGATTTC
CACAAAGAGCAATATCATTACAAAGCTTCTTACAAAATCAGAACGAACTCACAGCTAGCGCATCTTCAGCTTTGTCGGATGCGGCATAACACCTCGGCAA
ATGCATGACGCTTAAGTTAACGCGGTTGACTGCGCATTATTAGATATATTACCCGCGTTCAAGTACAGACATCTTAACACAGCAAAGATAAAGTAATATG
TTTATAACGAAGATCTACTAACGATAAAGTGTAAACGCATAGATCTCTTGTGCACTCTCTGAATTCTAACGCTTCATGGTCATAACAGACCGCGCATCTT
TATGGACTACCATACATATGCCGCTTAATCGTAGCGAACAAACATATGCTTGTTTTTTCGCGTTATGAAATCCCTCATTAAGATTGGATGGAAAAGCAAA
TTAAGCTTGTTGGCGCATTATCGCATCAACATGA