Description :
From Genome Similarity Track
Location :
Scaffold_3281:473- 1894
Transcript NameFunction/comments
Phypl_g15737hypothetical protein PHYSODRAFT_323774

Sequence
1421 bases(100 bases per row)
gaagaggaaggactGCGCCGCAGCCCCGGGAGATCACCAATGAtctcgatgagcagcaagaaagcttcaagctgctcggtcGCGCGTCCATCTGGCGGGA
GTGACTCCTTGCGGGACTACTTCCCGCCCGATGAGAGCTCGGGCTCTCCGTTGTtcttggagcagctcaagcccCCNCACGTCTCCAATGGCGCTTACGA
AATCGCCCTGGTTCATAACGTGCCTCTATTCGCAAACGACATAGAGGCCGCTCGGTGTGTGATCCTAGCACCACACAGGATTCCGTTGAAGGAGTTCACC
AATCTTcgcaagaaggccgagaacAAGGATGGGCTTCATCTGTTTGGGGTTACCCATGATTCCACCTTGACGAAAGTCGAGGCGGAGAATCTCTTCTGGA
AGTGGGTCTCTCTTCGGGGCTATTCCGCCCAGGAGCTCCGCGAACTCAGTGAGGATCGCTTGCTGACCTATGCCCTGGACCAGCGCGATCTGCGAATCGA
GTTCGCTCATCTCGTGAGTAAGCGCAAGCTTCACNAGGAACCGTATCCCGTAGAACGGCTAAAAAGCCGCAAACTACttacgaagctgctgtcgcttcTG
TTCCCAGATCGCGACAGTCTTCGGGCAGTCTGCCTGGAGCCGATCGATCGGCTCCCACGTGTTCTCGGACGCCGGATACCCGCGCCACTTcacaaggagc
tggcgaacGCCATGGCGCAGACGCTCCTGGAGCACCTGCTCCACGTGGAAATTCAGCTCAACATCTCGGTCGAAGAGGACCGGTGGAGGCCTCGCTCGAC
TATGAGTACGAGCCTCCTGTGAAGGGGGCTCCGAGGACTGCGGCTGCGGGGCCGACAAACGCGCTGCAACAAGAGAATATGCGTCTCTTCCGCGATCGAG
TGTATGCTCTCGAGATCGCGCTTGGTCTCGGGCCTGGTGGCCAGGCTGCTGCCCACTCCGGCAAACTCGGTGCTCTGGAGGGCTTACGTATACACTTGAG
CGGGAGAATCACGGTCTCTATGAGCGGGTCGATCGCCGTGCTCTGACCTCTGTGGTCGAGGACCTGCGGCGTCAATTCCATGACTTCCAGGCCCAGGTCT
ATGGCCGAGCGCCTTATCGGGAGGCTCAGCCGTACGTGTACTCCCAGCCGTATCAGTATGGCTCGTACGGGGGCTCGGCGCACGCGGCTCCAGCGTATGC
GCCACGGCCTTACGGCCAGCGGGACTATCCGACCGCTCATCAGGGGCAACCAGTGCCTGAGACTCAGTCTCGCTTCGAGGAGGTGGTCGATCCTCCTCCT
GGTGGCTACCCGCCGCTTCCTGCGGGTCGTGGTACCGCTTCAGACGACCCACATAAAACGGGTGGGTCGTCATCGACTTAGGCAAGTCGATCGTGTAGGC
AGCTCCGTGCCTACTCAGGAC