Description :
From Genome Similarity Track
Location :
Scaffold_43:47288- 48486
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14404hypothetical protein

Sequence
1198 bases(100 bases per row)
GCTTCAGTGCTGATTGCTCAACATGGTATGTACCACATCAAACTTATGTTGTGCACATTGATTCACATCCGACGTAATGTAGCCATTTCTAAACATGGTG
AGTGGAGGCAAGAAGCCTCGCCGGCAGCGCCGCGCTCGGCTCCAGGGCCCCGGCGCGCTGCTTCAGAGTAGCTCGGATACTGCATACCCCTCCTCTCGTC
TGCTTGTGTGGCACTCGCACTTCACACATGCCGCGTCTCGCCACGAGAGCGTTATCAATGGCCACGCCGTCAACCAGCAACTCGAAGTTTATCTCCCGTC
CAAAGCTGGGAAAGCTGCCGCGCAGTCGCTCCAATGGGAAACGGGTTTCTACTACGAAATTAAGGCGCCAGTCGACATGTTTCTATCGCCGACCTTCATC
CGCGAGTATCTGACGGACGGTGGCGCCGTGTTCATGGTAGCCAAGAACGCTCCGGTGGATGCGTCACAGTCGGCGATGCTGCTGCCGTCGGGCCAGTTGC
TGCTGTTGGTGGACGTAGAGACGTACCAGCAATTGGGCATCGTAGGGGAGAAGTACGGCAAGTCCATACCAACCACCAGCAGGTCGGCACATGTAAAGCG
AGCACAGAAGTACGTCATCACGCTGGACTTAACGTCGTCTGCATTCACCGAAGAAGGAGGAAATACCTTTAGAGATCGAGTAAGGAAATGTCTAAACTCG
AAACTGGAGGATCTTGACATGCTACTGTGCGCGTACAACCAGCGTGGATCGGCACGCACGATCTTGTTCGGAGACGATGATCAGATACCGCGCTCGCGTG
TGGAATTGAATGCCAAGATAACGACGTTCAGCGACGTGTTCCTGCCCAAGTTCGGCGCGTTTTACACGGAATTGGGTGCAAACGAAGAACATGCGGAAGA
GGATGGCGATACGCTTCGAACGTCGTTGCAGGAGGCTTACGACTGGTTGGGACTCGTGGCGTGTGGGCTGACCGACTTGCTGCAGCGACAGAAGCCGGAG
GAGTATGTGTCGACATTCACGGGTATTCCTGATTCATTTGAGTGTGAGCCAGATAGCGAGATCACGACCGTGCGGTGGCGGGGTCTGCTTGCGGCCCCGT
TTTGCTCGACTATTGTGGAGAAGGTGCAACGTGCTGTCAACAGTGGTGAGTTGCCTTGGGCTGCTGTCACGGTATGGGGTTTCCCGGATGTCTTCGTG