Description :
From Genome Similarity Track
Location :
Scaffold_431:4728- 5993
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_431-snap-gene-0.15Transmembrane protein

Sequence
1265 bases(100 bases per row)
GTATTCGCTGCTTACGGCAAGACCACAGTCCGATTGCTTCCCGTAAACAGCTTGTGGGGCACATTTGCAAAGCTGCTCGACGCGCGCGCGGTCGACGGCT
GCACGTCGATGGGCACCTGCCACTTGAAAATCTGGGTCGCATGGGCAGCCGGCGTTATCTCCTCGTCGCTGACCACGCTCGCTGTGAACTCAAACCGGAT
ACACCATTGAAAGCACACCAAATCAGTCGCGATCGTCGGCACGGCGTCATGCGGGATGGCAAACCGCACGTTGGTCTGCAGCGCCGACGCCGTGTACTCG
TGGTACGCGCCGACGACCTTGGACTGCACGACCTTCTTGGGCTGCAGCGCCATGCTCGCGAGCACTTCTTCGAGGCAGAGTGTCGCCGAGATCTCGAGGC
ACGGGATGCTGGCCTGGGAAAAGTCAAAGACGCCGAGTAGTACGTCCCCTGGGTGGTAGAACTGTTTCGTCAGCAACAGCTTCACGAGGTGCGAATCGTC
CTTGCCAATCGTGAAGATACTGGTCTGTGCGCGCTGGAGCTGCTCAGTCTCGATACGGCCGTGCATAAGTGATGGCCGCAGTTCAAACGGGATCTCGCTG
CCTTTGCGGACTCCGACGGGGACGACCGCGACGGATACAGCGCGTTCTTTGCGGGACGTACGGCGCTGCTGCTGGGCGGACGCCTGTGCGGCAGCCGATG
GCTCGTCGAGAATCGGTTGCGGGGCGAAGGAGAATTCACGCGCGTACACGTCGAAGGGCAAATGCACGGTCACGGGCGGCGTCAGCGAAACCGCGTGACG
GTAAACGCTGATGGACACGACGTAAAACACGCGCGCCGACGAGCCACGGAACGTCGGGCACAAGCCCTCGGGCAGCGCCAGGGCGAAGTCACGGCGACAG
CGGCGGTGCGTGTCGTCGATGCGCTCCGACGGAGTCGGCGCGACGTTGAGATCCGAGAGCAATACATAGGGCGACGACACGTAGAGACACGCGCCCGACT
CGCCCGAGAACTTGCGGATCTCGGTTGGCGAGAGCCCGCGCGGTGATTCGTCACTTGTAGTAGGAGTGGGCGTGACGACCACGGGCACGGAGAGCAAGTT
GCTGTCCACGGAGACATGCGCGTGGATCTGCGCGACGACGGCGTCGATCTCGGTGGACGCGTCGGGCGCCGAGTGGTCNNNNNNNNNNGACGCCGCGCAC
GATACCTCCGGGGCGAATGTACTTGCACGAAAGCTGCGCGAGCAGTCGCGTGCCCGTGGCGTCCG