Description :
From Genome Similarity Track
Location :
Scaffold_20:472791- 476459
Transcript NameFunction/comments
Physo_114425ATP-binding cassette transporter, subfamily B, member 13, group MDR/PGP protein PpABCB13

Sequence
3668 bases(100 bases per row)
TTCCTGGCGCTCTACCGCTTCGCCACGCCCGCCGACAAGCTGCAGCTCGTGCTGGGCGCCGTGTTTGCCGGCGTCAACGGCGCCATCTTCCCGTGCATGG
CGCTGGTCTTCGGCACGGCAATCAACGCCTTCGCCCAGGCGGACAGCGGCGTGGACCGCGACGCCGTGAACCGCGCCGCGCTCTACTACTTCCTCATCGC
CGTGGCGCTGTTCGCCACCGACTGCCTGGCCTACATCCTGTTCTGCAACTCGGCCGAGCGCCAGATGAAGGCGCTGCGCGGCCAGGTCTTCGCGCACATG
CTCTACATGGACGTGAGCTGGTACGACCGCAGCGACGCCTTCGAGCTGTCCAGCCGCATCACGGGCGACACGGTCAAGATCAAGGACGGCATGGGCCAGA
AGCTCAGCGACTCGATCAAGTTCACGTGCCAGTTCTTCGTCGGCTACATCATCGGATTTGCACGCGGCTGGGAGATGAGCCTTGTCATGGCCTGCGTTAT
GCCCTTCATGGTGCTCTCGCTCAAGTACATGGTGCGGCTATTCCGGAAGCGCGCCGTGCTCTCTCAGAAGATGTACGCGGAGGCTGGCGCCGTGGCGGAG
GAGACGCTCGGCTCCATCCGCACGGTGGCCTCGCTGAACGGGGAGAAGCGCGCGATCGACAAGTACAACGAGCGCGCCGTGCTGGTGGAGACGGGCAACA
TCGCCATCTCCAAGCGCTCGGCGTGTGTGTTCGGCTGCATGATGGGCAGCATCTGGCTCATGTATGGTGCGGGGCTGTGGTACGGTGGATCTAAGGTGGC
GAGAGCGGAGGCGTCGCCCGGCACAGTGTTCCAGGCCTTCTTCGGTGTGTTGATGGGGACGATTTCGCTCTCGCAGATCTCGCCCAATATCACGGCCGTA
GCTGAAGCAAAGGGAGCTGCGGCGGCAATCTACAAGATACTTGACACTGCATCCGCCATTGACGCGTCGAAAGAGAAAGTTGGAGATAAACCAGAGTCGT
GCGTCGGGCGCATTCAAGCCCTCAACGTCAACTTCACGTACCCGAGTCGCCCCGACGTGCAGATCCTCAACGACTACAACGTCACCATCGAACCTGGCCA
GACTGTCGCGTTTGTCGGTGCAAGTGGAGAAGGCAAGAGCACTTTGATCTCGCTACTCGAACGGTTCTACGACCCCAGCAGCGGCTCTATTCTGCTTGAC
GGACGCGACATCAAGACGCTCAACGTCAAGTGGCTGCGCGCGCAGATCGGACTCGTGTCGCAGGAGCCCGTGCTGTTCGCGACCAGTATCTTCGAGAACA
TCGCGGCTGGCGGAGAGGGGATCACGCGCGAGCAGGTCATCGAAGCGGCCAAATTGGCCAACGCGCACACGTTCATCATGTCGTTGCCGGAGCAGTACGA
CACGCTGGTGGGGGAGAAGGGTGTGTCGCTGTCTGGAGGTCAGAAGCAGCGCGTTGCTATTGCTCGTGCTATCGTACGCGAACCGAAGATCTTGGTATTG
GATGAGGCGACGAGTGCTTTGGACGCCGAGAGTGAGCGCGTGGTGCAGGCTGCACTGAACGACTTGATGGACAAGACGCACATGACGACGTTGGTGATCG
CTCATCGGCTGAGCACAGTTCGTCGCGCAGACAAGATTGTTGTGGTGAATGGCGGCCATGTTGTGGAAGAGGGACCGCATGATGAGCTGGTAACAATTGA
GCATGGAGTGTACCAGAATCTTTACAGGATCCAAGAAGAAAAGGCTCAAGAGGAAGCTGAAGCTGCAGCGACGGCATTAATTCAAGCTGGTATCGATGCT
CATGAGAAGATGACTCGCAAACTGAGTACCAGGTCGGTTGGGAGTGACCGATTTGTTGACGGCGCAGTGTTGAAGGAGGCCAACGAAAACGAACCGGAAG
GCACATTTACGATTGTGGACGCTTTGGAGTTCAGTCGGCCGGAGCGAAAGTTCTTCGTCACTGGTTTACTTGCTGCAGGCGTGAATGGATTCTCGATGCC
TTGCTCGGCTATTCTGATCAGTGAAATGGTTGCAACTATGACTACGGCATACACCAACTACCAGACATACGGCCTTCACTCGTACCTGGACCATCTCTCT
AGCGACATCAGGATATACGGGCTGTGCTACATTGGAGGGGCTGTGCTCTTGTTCATCACGAACGCTACACAGAACTTCTGCTTCCGGTACATGGCCGAAA
AGTTGACTTCAAGGCTCCGAGGCATTCATTTCTCAGCCCTCTGCCGGCAGAACATCGGCTTCTTTGATGAAAAGAAGAATGCTACAGGGGCTCTTGCAGC
TGATTTGTCGACGAACGCCACGAAAGTTGCGATGATCTCAGGGGATTCTCAAGGCCGTGTCGTACAGGCAGCGTTCACGTTTGTCGCCGCGCTTGTCATT
TCGTTTACGACGGGCAGTTGGCTGCTGACACTCGTGATGCTGGCTGTCTTCCCACTCCTTATTATTGGGCAAGTGACCAGAATGCGCCATGTCCGCCATG
GAAATATGCTGTCCGATGAACTGGCAGATGTCGGCGCGCACGCATCAGAGGCACTGACCAATATCCGAACGGTTGTTTCGATGGGCATGGAGAAGTCTAT
GACCAATAAGTTCATGGACTTGCTTGAAGAGCCCTTAGCTAGTGGACGTCGAGAGGCGCGACTGAACGGTGTTGCGTTGGGGTTCAGCTCCTTTATCGTC
TTCGCGACATACTCGCTCGTCTTTTGGTACGGAGGCAAGTTGGTCGACGATGGAGACATCACGTTCGCGAAGCTCATCCGCACGCTGATGGCGATCATGA
TGTCAGCGCAAGGTGTTGGTAGTGCCGCTTCTTTTCTTGGTGACTCTGATAACGCTGTGAAGGCGGGCAAGGCGATTGTTGCCATCAAGAATCTCGAGCC
GCCTATTGACTCCTTCGATGAATCTGGTCTTCGCCCTGCTCATCTCGAGGGCAAGATTGAGTTCAAGAACGTCAGCTTCCGGTACCCAACACGACCTGAA
GTCACCGTGCTGCGCAACTACAACCTCACCATTGAAGCTGGTCAGACCATCGCGTTCTGTGGACCAAGTGGAGGTGGCAAGAGCACTTGCGTCTCGCTCA
TCGAGCGCTTCTACGATCCGGTTGATGGCCAAGTGCTGCTCGATGGCGTCGACACCAAAGAGCTCAACCTCAACTGGCTGCGCAGCCAGATCGGACTCGT
CGGACAGGAGCCCACGCTCTTCATCGGCACCATCGCCGAGAACATCGCCTACGGACTCGCGGACAAACCCACGCAGCAGGACATCGAAGAAGCCGCCAAG
ATGGCCAACGCGCACGGCTTCATCACCAAGTTCCCGGACGGCTACGAGACGCAGGTGGGCATGAAGGGCGAGCAGTTGTCCGGCGGCCAGAAGCAGCGCA
TCGCCATCGCGCGTGCCATCCTGAAGAACCCCAACATCTTGCTGCTGGATGAGGCCACGAGCGCTTTGGACTCGGAGAGCGAGAAGGTGGTGCAGGAGGC
TCTGGACAAGGTGGTGGCGCTGAAGCGGCGCACGACGATCATCATCGCGCACCGGTTGTCGACGATCCGCAAGGCGGACAAGATCTGCGTGGTGAGTGAA
GGCAAGATCGCGGAGCAGGGCACGCACCAGGAGCTGATTAATATGAAGGGTATCTACGCAAAGTTGGT