Description :
From Genome Similarity Track
Location :
Scaffold_127:47278- 52799
Sequence
5521 bases(100 bases per row)
CCCGTCACACCTGGTAGCACTTCGTAGTCCGTCCAAGGACCGCAACCCCCGCATCCAACATGAACATGTTGGATGATGATAGTGAAAACTTTCACACCAC
GTGTGAAAGCTACCCCTATTTGAGTGAAATCAAATCGATTGTGGTCGAACGACTGGGTTCGACCATCGGCGAACATGCCGTCAGTGCCATGCTGTCCGCA
CTGGATAGATATGAGTAGCATGCCGCCGTCGCCAAGTTCATACAACATGAACTTGACGAGTCACGGGAGAAAGTAAGCTTGCTTCACCAGCAAGGTTCTC
AACAGGCAGAGATGTTGAGATTACAGAGTGATCAACAGTTCGAACTGTTGAGACAACAGCAGGCACATTCTGCTGTTCCCGAGGAGACGCTCGCGCGTCG
ACCCGAAACTTTGAAGATAGACTTCTCATAGTACAGAGGAGTCGAGGGAGATTCACTCTTGAGGTGATTCGCCAATTAGACGACGCCATAAGAGCTCGTC
AAATCATTGATGAGCAAATGCAAGTCGTATTTACTCAGTAGAACTTGGCAGGACGTGCCAAAACTTTAGCACTAGGCCTCGAGTTGCACGACCCATAGGT
GTTTGGGTCGGTGGAGGTCTTTAAGGCCCGGTTCAGACAAACATTTGAACCGCCACGGGCTGAGTTTAGGGCTCGATCAGAGCTCCTCAAACTCAAGTAG
GGTAAGCGTGATTCGCCCGCTTACGCCCAACATATATGACTCCTTGCGGGCTGCATCACGGCCGCCCGGTCCATGAACACACGTTCATTACGGTTTCATG
TAGGGCCGTGCAGATGGTCCGTCAAGACCCACCTGTTCCACCTGGAACTGAATACACTAGAAGAAGTGATATCAGTTGCGGAACAGGAATACGATAGCTT
GAGACAGGCTTACGCTAGATCGGGTTCATATCGTCTTCCAAGATGACAAGAAGTCGGAGGTCCAGAGCCTATGGAACTCTGTTATGTTGAGAGAGAGAGA
CCACTCTCTTCAAACAACAAGCGTTTGCAGAAGTACAACCGATATCAGAAACTAGGCCGCTTCATCTACGAGTGTAGTGTGCTACGCCTTGAGTCTCAAA
ACATCCAGCGAACTGATCTACCGTCCGCCAAGGGGGACAACGGACGCGGGTCCAACGTTATCGCGAAATTGCAACAATCGATTGAACCGTCAAAAAACGG
TCGGGGTCAGTAGGGGAGGAGCGCCCTACTGATCCAGCAACCTCAAGAGAATTTGCAAATCTATTGGTGAAAGTTGCTCCAGACTCACAATCCTTGTCTG
TCTCTGCACTTGGTAATGAGGTACCCCTCATCACCTTGAATTTAGAAGTGACAAAAGATTTGTCACTTCGTGCCCTAGTTGACTGTGGGGCGTTGAACAA
CTTTGTTCGTTGCCAGTCGCTAGTGGGTCGGGTTCAAGTTCGTTGAGCGCGAAATCCCTCCAACGAGGATGACGGTGCGCCTAGCAACAGGCGCATCGAT
AACATTGATGCAACGTGTAGTGGGACTTCACTACACGCTGAAAGATTTGCAGTACGATGATAATTTTATCGTACTATATTTGGATGACAAGTTTGATGTC
ATCCTAGGGTTACCTTGGCTCAGAAGATACGAGCCAAGGGTGAGCTGGCAGCACCGAACCGTATAGATGCCTGCCACTTGTTCATCAGATGACCATCTGA
ACGTCCTGTAGCGTCCACAAGAGTGTGGGTGTACTGTGAGTGAGTGCGATGGTCTCACTTGTGGTACGGTCGTTAGCACGACTGCACACGATCGCAGTGT
GACAACCAATCACACTGTGGGGGAAGCTGCCGGCGGCTGTGCGGATGCACAGGCAACACCGAAGGTCCACCACTCGAACAAGTCGAGTGGATCGGAACAT
GGGTGTACGGCTAGCGGGCGACATCCAAGAAACAATAAAAAGGTTTCCCACACAGAGCAACAAAATGATCCTAGGTCGACTGGAGAGTCAACCGTAGAGG
AACTGGCTGTGATAGCGCAGCCACAGCTAACAGACGTCGAGGGAATAAGTCTCCACGTACTTGAGGAAGGAAGGAATTCCTCAAGCAGATATTGTGAGGT
AATGATACCTCATCAACCCGAGCGAATAAGTCCCCAGAAACCTGTGGAATAGGTTCCCAGGAAGAAACCGAGACATTGAATGTCTCGGTAAATGAAGGGT
CAAGTGTAGGCGCTTATACACTTGATCTGATCGCGCCTCCGAAGTTGACTTCGGAGATCACTCAGTTACCTACGCTAGAACCGAAACGGTTCTTGCGAGA
TCTGCGTAGTGGCAAGGTCAAGCAGATCTGCGAATTCGTCGCAGAAGACGAGTACGTGACCGACATTCGGTTGGCAGTAATATTTGCCGAGAACGAACGG
GTTCTCAGCAGCTTATTGATGAACGAAAGTGTCCTCAATGAGAAGCTCGGATTAAGTGATACGCGTCTCAATATTGGTAGTCGCTTCAAGCAAATCCTTA
TATAAATGATTTGCTGTGTTCCCTGAATCCGTACCATGCGACTTGCCTAAGGATAAAGGCACTCGACATGAAATCGAGCTCAAACCGGGCTCGAAGTACT
TTGTCATGAAGCAGTGGCCACTGCCTCGTGAACAAGTACTTGCGATCGACAAGTTCTTTGCCGATCGCTTAGTAGCGGGCCATATGAGGGAGTCAAACTC
CCACATAGCTTTCCGATCTACTGTGTGCGCAAGGCCACAGGAGGATGGCGGATAGTGCATGCATTCAACAAATTGAATGCTGCAACGGTACCGGCGCAGA
CGCAGATACCGGGGAAGGACGTCATCATAGATGGTATGGCAAAAAGTACCATCGTTTCGTCCTTGGATCTGATGAATGGCTTCTATCAGATCCTAATGCG
TGAACGGGACTTTCCGTACACAGCAGTGAGCGCCCCAAGCGGTATGCTCTGGAAGAGACTAGGTATGCCACAGGGATTAAGTAATTCCCCTGCCACATTC
AACAGATGCGTTACGTATCTGTTGAGATCTGTGCGAGAATTCGCACCTAGCTACTTCGACGATGTATTCGTCCAAAGCCGGGCTATGGGCGGAAAGACGG
ACGTAGAGGTTCATAGAACACACGTTCGTCAGGTTCTTACACTCATGCGCAAGCGTAAGCTGTATGCCAACCTCAAGAAGTGAATATTCGATGCTAGCAA
GATACCACTTCTTAGATGCATCACGGGTAAACACGGCGTACGCCCTGATCCTGAAAAGATCAAGGAGATTACCGACTGGCCCGTGCCAGTCGACGTTAAG
GGACTAAGAAAGTTCCTTAGTCTAGCGGCTTACTTACACAAGTACTCGCGCAACTACGCTGAGATGACCGTTCATCTCTCTCGTTTCTTGAAAAAGAACG
AGATATGTTCATGGAACGCTGATTTTCAGCGTTCCTTTGAAGGTATCAAGCAGAGCTTAATGCAATCGTCCATCTTGGCGACTGCAGATCAGGACAGAAC
ATTTCTTGTGGTCTTTGAAGTCAGCGATTTCGCAATCGGCTGCACGCTAATGCAGTACGATGCAGACGGCGTAGAGCGGGTCGTCCGCTATCTGTCGTAT
AATCTGCAAGCAGCTGAGCGTAATTACCCAGTGCATGACAAGGTACTCCTTGCCATGAAATATGAACTAGATAAATTTCGCATTTATCTCCTAGGAGATA
GACCATTCGTAGTCTATACGGACCATGCGTCATTACGTACGGCCGTAAACAGTCCACACCTCTCCCAAAAGATAGCAATGTGGCTGTCCTTCTTCGCGGA
GTATAAATTCTCCGTGTAATATAAGCCAGGAAGACTTAATGTCGTCGCTGATGCGTTTTCACGCCGACCCGATTTCGAGTCGGCTGCGCAACCCAACAGT
GGGTCCGGTCCCACTGTTACAACACTAGTCGCTAGTGTTCCGTTGCCAACACTGGTTGACGACATTAAGAAATCTTACGCAGAAGATAAGGCTCTTCTGC
GACTGATGGATCATCTGTTGAATCCATCTCGTAAATCTCTCAAAGGGTAATCGGCCTTGTATTGATCATCCGTGGATCGACAAACAACACGCAACGGGTT
GCTGTATTGCGCAGCTGTTGCCGGCGACACACCTCGTGTCGTCGTTCTCACTCATAATAATTTGCGCTTACGTATCATGTATGAGTGCCACGATGCATCA
ACTATTGGGCATCGTGGGCGAGAGAAAACTTACCTCACAGTAAGCCGCGAATTTTACTGGCCTCGCCAGTAGCAGTTTGTGCGCAAGTACGTTCGTGATT
ATGAGGTGTGCCAACGGGTGAAGCCTAGTCCTTCATCCCGTGCACCACTACAGCGTCTACCAATCCCGGAAGAGTGCTGGCATTCCGTTTCAATGGACTT
CGTCTTCGGATTTCCCGAAGACGGACGCAAAAATAATCGTAGCCTTGTGTTCGTTAATAGATTCAGCAGGATGGTACATCTTGCTGCTGATCGGGATTCG
CTTTCAGCTCACGGCTGTGACCGTGCCTTTATTGACACAGTCTTTCGACTCCACGGTCTACCCCATGAACTAGTCTCTGACCGAGATCCACGGTTCACGG
CGGCATTTTGGCAATCCGTGTTCCGATAACTCGGGAAACGCCTAATAATGTCAACATCTGGCCATCCAGAGACAGATGGTCTGACGGAACACGTTAACTT
TGTCCTCAAATATACTTTCGGGGTACGCCCAATCTTTCACGAATCGAGCGACTCCTTGCCAATGGTAGAGTTTGCCATCAACAACTAAGTTTGTGCATCC
ACAACGCATACACCGTTCTTCGTGAATGGCTTACGCCATCCACGCCTACCCGCCCACTTAGAGTGTGACTCTGGTTCAAGGGGGAGGAAGAATTTGCTCA
AGCAAAAACCATTCTGGCTCTTGCTCATCACGCGTCAAGGTACTCGACGACGCGAACGTTGCCGATGTCGATCAAATCGACATCGAAGCTGATAACCTCA
GCAATAGTAACGACACTATTGCTGACCCAGGTGAGGATGACGATGCTGGTATATTCAGCATCGCCAATGACTACACCAGCGAGGATGAGAACATCACAGA
ACACTCGCTGAAGAAAAGGATGGCCTCCTAGCGGTGCGCACAAGGCGCACTGCAACAAACAAAAGCGATTCAGCAGAATATTTTCTGGTGGCATGAGAGG
CAGTGGTCCGTTTCGTACAACACACCATCGCTAACGCGGTGGACCGGCAGGAACGGAACGCTGATACACATGGAAGAGAAAACGCTCTTTTATTTATGTT
GGAGACTTAGTCTTACTTTCTACGTTAAACTTACCTAAGCACGTAGTAAAAAATGTGGGTAGTAGTATACTACTACCCTAGTACATCGGCCCGTGTTGTG
TACTACATTGCAAAGGCGATGCGTACAGGATCGAGTTGCCCCGCAGGATGCGTACGCATCCTGCGTTTTATGTCAGTCGTCTCCGCCCGTACCATCAGCA
CGAGGTTTCTTCCTCGGGAGA