Description :
From Genome Similarity Track
Location :
Scaffold_60:47261- 51447
Transcript NameFunction/comments
Phyci_229523Hypothetical protein
Phyci_229271conserved unknown protein

Sequence
4186 bases(100 bases per row)
TTGGTGCCGGTCTTGTGCATGCACGGATGCGTGAATCTGTGCGCTGTTCGGTGTCGGATTTCTCCGCGGCGGATCTGCACGCCCAAGTCCACGACGCGAA
GATACTGCAGCACCCAGTCAGTCAGTACGACGACAGCCTGCTATTGCTGCGTATTGCCAGCGAGCGCACCATCTCGAACCACCTGGCAGCCGACTGCGGC
GACAGATTCGGCAGCGCAGCCGTCTCCAGCTTGTCGATGGCACCGCTGTACACGGCCTTCAGCCGCTCGATCTCGGCGAACGCCGCCTTGAGGTGCGTCG
ACAAGCGCTGGCCCTCGCCGGCCATCAGTCTCTCTCGAAAATAAAAAACTGACGCCAGCCAATGAAAATCCATTTCGCAAATTGAAGTGCGTGTCTCGCT
CTACATGTGGCCGTCGTGGTCGGCGTCGACAGCTGCGCCGCCGTTGCCGCCGCCGCGCTTCCGCTGCGCCAGCTTGCTCCTGCTGGAGGCCTTGATGACC
TCGCGCGTCATCACCTCCGGCTCCTCCTCGCCCTCCTCCGGCCCCTGCGCGCTGTTGGTGGGCAGCTGCAACAACGACTGCGTGGCCAGCACGGCGCTGA
TGGCAACAGCCAGAGGCGGCACGGCGCCGCGGTCGAAGCCCACGCGGTCCTTGTCCTTGTCCTTGACCTTCTCCACCACGCTGCTGAGCTGCTGCGTCCG
GCGGTAGCGACTCGAGCGCGTCGCCGCCTTCTCGTCCCCTCCGCGCGTCGCCCGCCGTCGGGTCCGAGACGGCGAGTCTGCAATCTGCGCACAAGAGCAC
AAGGACGGTCACATTTCTTACCACCAGTACAAGCCTGAAGAAGAGGAGACAGCTGTCGTACCAGGGAGAAATTAATGTCCGGGTCGCTTCTCGCGCCCTC
GATCTGTGAGGACAGACACGACGACCAGAAGTGTTAGCCCAAGTGACACAAGAGTGAGCGAGATTAAGCAGGATGGGGAAGGCAGAAGACACCAGACAGT
GTGAGTAAACCTACCGCGTCTATCATCAGTGTCGCCCGGTCTTGGCAAAGCTGCAGCATCGCCGCAATTGCCGGTGGTTCGAGGGTTTCAAACTCGGAGG
TGAGGCTGTTTTCTCCTTCGTAGCCTACGGGCGGTGGCCAGAGACGAGCAGCGGGGATAGCGTTTTGATATGGATCCGAGCAGTTGGTGATCCCCATAAG
CTTCACGATTCGCGCGGCGCCTGCAATTACCTCCTTTGAGCTGGTCAGGAGGCTCGCCTGCGTGTACTCGGCGCGTGCAAGCTCCACTTCGGCTGCCCGA
AGTTTCTGCTCCAACAACCGCGGATCTTCTGTTGAAGCTGTCGCCTGTGACGTTTCCAGTGAGTGGAGCTGCTCCTCAAGCTCGGCTTGGTTGAGTTTAA
TCTGTTTTAGTCGAGCTTCATAGAGCTTGGCTTGCTCCTCAAAACTTGCGTTCAGCTCCTCGCGCCGCGTGAACTTTTGAAGAATGAGCTCCATCTTGGA
GAAACCAGTCGCCTTTTGGATTTTCTCGCACATGGACTCGCACTGCTGAAGTGCAACTTTGGCAGCTAATGAACGAGTTGTTGCGCTAAACGTTTGCCGG
GCTTGTTTACGAGCCTCTTCTTCGATAGTCGAGTTGGACTCTTTTCCACTCGCCGTCCGAACGCTTTCAATCATCTCCAGTCGGCGTTGGTACAACTTCT
CAGACGATGCCTGATCATGGGCCACCTTCTCGCGGGAGCGTTCGAGTTTTTCAACTACGGCAGACAGCAAGTGTTTGCTCTTTTCAACCGCCTTGCGTAC
AACAGGAAGTTCTTCGTTTTGCAAGTGAGCCTTTTTCATGAGAAGAACCTTTTTTTCGGCCTGGAGATCTTTAAGTTTCATCTGCAGCAGACGCAGCTCC
TTTTTGTTGGCTTCAAAGTGCGCTGGTGCGCAAGCTGGAAACAACTCACATCCACGAATGAGCTTACGATGAGTTTTTTCCTGGTGGTCGATGTTTTTCG
TCACCTGCTCAAGTTTTGCCAGGCGAGAGCTCATTTCCGCTGCGGCATGTTTTGCCATGTCGCACTCACGCATCGTCAGTTCATATCGTCGTGTAGTCTC
TCGAATCTTTCGCTTCACGTCTTGGAGGTACTTTTGCTTTTGAGCCACTTCAGTTTTCACGGTATCGTAAAGATTTTGGAGTTTCAGCACTACTCGATGG
TTATACGACTGTTTTAAGTCCCAATCAGACTGAGGGTAGTCCTGGAAGTGGGCGGGTAGTCCGAAGGATGTCGCGATTGTTACTAAGTCCTCAGTGCTGG
CAATACTGTCCAGTTTTAGTTCCTTTGAGGGAATTCCCGGTTTCATCAAGGCTGCATTGGTGGGTGATTGTGCCGTAGACCTGTCTGCAGACATCGGGTC
GTTAGAGGACAAGTCTGGGTTTTTTGTAGACTCCCTGCGGTTGCCAACCGGAAACGTCGAATTTTGGACAAATGTTCGCTGCTCTTGCAATGATGGCAAT
GATGATGATGACTTCAAAGCTGCAGTGGGGAGGCGGCGTAAGGATGATGTCAGCACACCTTTCACTGTTGTGTATGCAGTCTTCTTGCGAAAGAGATGTT
CTGGAGATATCATGTCCACTGTCTGATTCACGAGCGAAGTCGACACCGATGTCATCAGTACACTCGCATTCTTCACTGCAGCGAGCTGCGAAGTAGTCAT
TGCGCCTCGAGGACGACGAGTGGTGGGGTCAAACATACTCTTCTTCACGTCCCAAAATCGTGCGTCGAATAGCCCAGATCGAGCCTGCGATAAAGTAGCA
GTCATTGCGGTCTTCGCGTCTCCAGCATTGTGTCGTCTAACTTCTTCGTCACTTCCGTCTCCTGGGCGCCCGCGAGATGAACCTAATGGAAGCAACGAGT
TTGACGACGGCGCATGCGGTATTGTTGGGACCGACCCCGGAGCGCTGTTTTTGTTACCGACACGTATCACCGTTGCCTTCTCGAGAATGGGATTCTGCAC
AACTTGGTCTCGCACGACAATCTCCCGGCCGAGTGCAAGCCACGGAAACTGGATCCAGACCCACCTCTGGTAGAAGAAGAAGCAATTTCTAAAGGATTCC
TTGTCTTTGATAGTAGAGCTTAATGTGGTGATGGTTGATGCATTCGCTGTCGGCGGAAAATTATCTAGCGCTGTCAGCAGTGCAGATGACGCAGTTGATA
GTGTACTTTCCATGCTGGAGATACCACCCAAAGTTGAAGAACCAGTTGTTGATACTGAAGACAGCGCAGCTACAGAGGTGGTGCCTACAGCTGAGTTGCC
GACCGTCTGAGCGTGTGGTAAATTTTCAACAAACAGGAACCCATCCAAATAAAGCCTCTTCAGATCGAAAGGTGCATGTACGAACTGGGGCAACGGGCGC
TGATACGACACACAGAATTCATACATGAAGCGAGTGATAAGTTGCACAATCGCTGTAAAATTCTTCGTGCTGGGGCGTGCACTGTGATACCAGTCTGTGA
TGCTCTTTCCGTACTCTTTTACAATATCGAACGGCATAACATAGACTGGTGGGTCAGACGAACGCTTTGCAGCGCCATAATTGAGCAATGGACCATCGGT
AAGGACCTTCCAGTACCCATAAAGCTCCGCTTTGTAGTTGGCTGTGTACAATAGTTGAAACATGGGCAGGTTCACAAGTACTTGACGCAAAGCATCCCAC
TGGTAACAGCGCTTGAGATGCCATGGTAGTTCTTCGACACGGCGGAAAGTAGTAGGGTGAATGCGAAAGAAACGAATGAGCCACTGGTGATATTGCTGCT
CAGCGCGCTCGCTGCCGATGTATCGCCACCAAATGACGTCGCGCAGTATGTCTTTGCACAATGGTAACACCACTACCTCTTGGACGAAAAGCACACTCAG
CGTGCGTAGCGCGCGTAAGAGAGCTTGCCACTCGTCCTCTGAAAAAGCTGTGAGAAGCTGCTGCCCCATGCTTGATTTTCCGGCTGGGTGATCAAATGCT
GTACCTTCATCATCTCGGTTATCTCGATGGCGATGAATACCTCGTGACTCGGTTACTATGGCATTGAGAATGAAACGCAGTTCATTCAACAGTAATCCGT
GACGACTGACATAGAGAAGGCACAGTGCTCGCCCAAGTAGTTCCCCAAGTGGCGCCACAGTGCGTCCGCCCGTCAGATAGTCTGGC