Description :
From Genome Similarity Track
Location :
scaffold_168:4725- 8595
Sequence
3870 bases(100 bases per row)
GGTCGATAGCAGAAGTACCTGCAATACATTCTTGGATTTTAGATGATATGAGAGGGTTATGCTGCTGAGGAAAGATGTTGTTTAATACGCCGACGGGGGG
CGTGGTGGTGGCCGTACGCTTTACGGATCTGTCCGAGAAGCTGCAGGATCACGTCTCGGTCGCCTGTATATATGGCGTTGGTACGACGTAGTAGGTGGAG
AGGCATGGTCTTCTTCTGCTGCAGGATGTTCAACGCCTTTGTGATGTTGTGCAGAGCGCTTGCTTTGCTTAGTGGCTGCTTTCCGGACGGACGAGTGATA
CCTGGAATGCTTCGCATGAACTCCACCTTTTCAATGATGCAGCACAGCAGTACGCCGGACTGGAATTCGGTCAAGTTGGACTTTGAGTCCTACAAAACAA
ACGTGGTAACATGAAATTTTGAGTGATAAAATGTAGCCGACAATGCAAGTTTCGTACGTGAAAAGCGGAAACTTTTGTGAGGCGAATTCCCAAGCGGTTT
AACCACTCTAGGATTTCCTCCACAGGTTCTTGCAGTGCTTTGCCTCTCGATTGTGATAATATGACAGGAGAAGGTTCTTGAACACTGTCATAATTATCTC
GGACTTGCAACTGTACGAGATCGTTATAAGCTTCTGTCGGGGCTGCAACGTCAACTGTTTAACACATTAAACATTTTAGCGATACTTCCAAGTGTTTAGT
GGCTACAACAGGTTGCCAAAAGCTACATACACACCCGACAGTTCTCCAAGAGCAATACTCGGCGGCATTTGGTAAGCGAGGCTTGAGATTTGAGCAGAGC
CACTTGTACCTGCTCGAATAGGAAAAACGTCGGCCCTTACTTGTTTTCCCTTGAGGTCATCGCTGTAGGTCGGACTAGTAAAGGGTGCTATCGGCACTGG
AAATACGTCATCGTCGTCGGGGGTACTTTCACTCCAAGCTAGACGCCGAGCGAAGGTGTCGTGGAGCTCAACCTGGTACAGATCATTCATCGCAAATTTT
CCTTTACCCGCTAGGGCCACAGCTGGAATATCAAGCAGCAGCGGAGAAGGCTTAAAAGGGGCTACCGTTTCCCTGTCTGGCCCGACACCTTGGACCATCC
GCGATTCACCAAGACCAGCGAATCCTCTGGTCTGCCAGAGATGCCACAAAATCCCGTAAATGATCTGCCGGTCCCCGGTGAGTACAGCTTGTTCAGCAGA
GGAGGTTAAGTAGCACAGCGGGATCTTTAGATCTCGCAGCCTTTCAAACGCCTTGGAAATGTTTTCTCTGAAATACGTAGGAATGATAGTGAGTTGGTTA
ATAAATTCCATCGCCAAACTCACGATACCAACCTCATTTCCATCAAAGTTCGAGGGGTCTTGAAATACGAGAATGATGCGTCCTTCACTTGTTGATTTAG
TGCACTACACAATCGATGTTGCGAATTAGTCGAGTACTTATTCAATGATAACCACGTAAATGACAAGTTACCAGAGTAAAACACCGTTGCGCATGGGGTC
CTGCAACACCCCACGACCTGAAACCTGTGCCATGAAATACACATGAGCTCACCCTCCAGCTTTGTGTTATTCTCGTACACTACCTTTTTGCCGTCAAAGC
CAACATCGGTAAGCCACTTGTTCACCACGTGCATCTGCTCAGTCGTAATATAGGGCATGCTACGATTCAATGGAGCACACTCCGTTAGTCCATTCACCGT
AGTGTTCACTTCAATGCTCCTCCTTCCTTTGTTTTGAGTCTTCGGGCTGAGTCTTTTCACATGACGTGAGACGTTCCCGTCCTTTTCCCGTATCTCCAAC
GTTTTTTCCGATCTCGAAGCTTTAAAAAAACGTTCCGCCTGGCTCATGACTTCATCTAGCGCATTCCAGATCGTCTTTGTTGAAATTCTCTTCGTTGTCC
GCTGCATAGATTCAAACACACCCAAAGCTTCCGGAGAAATCCCCAAATCTTTAAATACAGCGAGCGCAAAAGTAAAATTTCTCTGCTTTTCTGTTGGTCT
GTGCAGATCATTCGCAGCTGGTAAATCCAAATCTTTAGCTGCGATGGTGCTGCATTTAAGCTGTTCACTGCAACGTATAACCACCGCAGTAGCAATACGA
CGAAGCAGAGTGCCGTTCGCAAATGCCATCCCAATTTCTCGTGGCGGCTGCAATTTCCAGATCTCTGACTGCTTGGTAAAAATCTCGTCGACAGGCATCT
CAATATTCAACACACGCCTCGCCAAGTTGCAAAAGCACTTTGCACGAGAATCGTCAACGCTCTGAACACTTGAGCGTTTACCGGTTTTAGCACTAGGATC
CAGCATTCCAAACGTGCGGGGTTCATTTCCGTCGCTTGTCCGGTCCGATACTTTCTTCCGCTCGTCAGTTTTGCTTGCTGTTGCTGGGGTGGCTGTCCGT
TTGCAGCTAAGCCTCCTCTTGGTGGGTTTTGGCTTCTTTTTCGATTGGTTTGTCGCTCTGGAATTTCGCGGTGTGGTGTCCATCTCGGTATAATCCTTGA
AAGGCTTACTGTTAGGTCGCGATCGAGACGGAGCTGATCGTACATGCTTAGGTTTTTGTTTAATCATCACATTATCCAGCTCTCGAGGCAATTTTTCAGA
CATTTTATCCTGATGCAAGGCGCTTTCGATCATTTGTTCTTGAACGCCACGTCTCCAAAGCGCGTCCTTGTCGTCCTCGGACAATTGGTTCTCTTGGCTG
CGTTGGCAGTTTAGTCTCCTTAGAACTGTGAGCACAGCGCAAATTGTGTCGCTTTCACCTGCCAGTAGTCGCGTTAAACACTCCGCGTCGTTCACTACGT
ACATTGCATCTCCGTCTTGGCTCCTGCACTCGCCTGCAGTGAATTGGACAACTCGACGGAGACGCTCCGTGATTTTGAATTGGTCAAGCGCATCGCCCCC
TGATACTTCCTCGCAGTGATCTGCATCCGTTGACTTGTGTCTTCCCTGCAGCCACTGCACAATTTCGACCAAAACATCGCCAAAGCGCAACTCTCGGAGC
TCCTCGACCAGCAAACACTTGGTAAGCGGTAACGAGTTGACCCAGTGCAGTAATAGTCGCTCGTGGATCGAATCATCTGCATCTTGTGGAGTGCCAACGG
AGAGCTCCATCGTCCACGAACTCGGAAGGTTTTGATCTTGAAGAGTCACAAAGTCAAGTTCACAATACCTAAATGAAACAATTGCTAAGTATGTAATTCA
TCTCTTGAACACAGGCCTTGCAGTTAAATAATACGTTGTCTTGTGAAACTTACCTGCATCCACTGCACAATGCATGTCGTTACAAGCGTCATCACCAAGG
CGCAACTCTCGGAGCTTCTACCTTTCAAATGTCAAGTTCTACGACGGATGAGTGTCAGCGTGCAGTACTGTAGCTTGCCGCAATTTTACTAGCTTTGTGT
TTAGCATTGTGTGGCTTCAACAAGCACATCGAAATGATGACGCGAGTTGTAAGGACCGCGAATCGCGTCTCGAACAGCCAAGTTGAAGTGGCATTCGGCT
GTTGAGTCCGCGTCAAAGGAGCGGCGAAGGAGAGAGTAGAGCTTCGGCCAACGCAGTTTCCGGGACTCACATCTGCCAGAGCCGGACGGTTGAGCACGAG
CTTTGCTATTGAAAGGTTCCATGATAGAATTCTCGCCAAGATGGCCTCTCTTCAAGAGAGAACGCGCGTGTTCTCCTGCAGCAGTGGCAAATCCCAACCA
TAGACAGAACGGAGAGAAACTCGGGTCGCGTCCATGACGAGATCGTCGCCGCTTTATCCGCCGAGACGTCACGACTTGTCTTGGTGTCCACGCTTGCGCC
GTGACTAGACTTGCAAAGAAGAGATGCCTGGGTTCGAGTTCGCTCTCTCTGTTGGACGTCATCACGGTGG