Description :
From Genome Similarity Track
Location :
Scaffold_1217:4725- 6871
Transcript NameFunction/comments
g15065.t1hypothetical protein

Sequence
2146 bases(100 bases per row)
GCGCATACTTCGGATGAAGACGTCGATGATGCTGCGCTGGACCTGGACGCGCTGGACCTGGACGACAACGATGGACCGCGCCAAACGAGCTTCAAGCAGG
CGGGGAAGCGCAAGAGCCGACCGAGTGGCGACGATGACACTGCCAGGAGATCGCGCCCCGTTCGCCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGA
TGTATCCTCCTCGCGCCGAGCTGAACCCGACGAAGAAGAAAAGTCTGGGGACCAAGATGAAGACGACGACTCGACGCCTCCAGTGTTTTGGCGTGCCAGT
GCCAACGCTGTGGATGCAGCAGCCGATCTATCGGAGCCGACGACGTTCCAAGAGGCTGTGAACGGTCCGGATCAAGTGCACTGGCGCAAGGCGATCCGCG
CGGAGCTCAAGTCGATGCGGCTGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCCAGCGGCCAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCG
CAAAGCGGACGGCTCGATCGAGAAGTCCAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTG
GTCAAGTACGTGACGCTGCGCATGATCATCGCGATCGCCAAGTACTTCGGCTGGTCCCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCA
TGAAGGAGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTTGAGCTGGATGGTGACTTCGACTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGC
GTCACGCGTGTGGAACGAGACCTTCGACGAGTTCATGTGCTCTATCGGCTTCCAAGTGTCGGCCTTCGATCCGTGCCTCTACATCAAGGGGGTGGACGGT
CACTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCGCCCGAGCTGATCTCGCGCACGAAGACGGAGCTGAAGACGCGCTTCG
AGATGACCGACAGCGGCAAGTGCGCATTTGTTCTTGGGATCGAGCTGGTGGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGACGA
CATCCTAAAACGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAAC
GCTCCGTTTCGAGAAGCTGTTGGTGCGCTGATGCACCTGATGACCGCCACGCGCCCGGACATCGCGTACGCCGTTGGCTATGTGTCGCGCTTCATGGAGA
ACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCACCAAGGCGCATGGCATCTGCTTCAAGCCGGGCGACAAGATCGA
CTTTCGTAGCTACTCGGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGGCTACGCGTTCATGCTGATGAGTGCGCCTGTGAGCTGG
GGAAGCAAGAAGCAGTCAAGCGTGTCGTTGTCTACGAGCGAAGCGGAGTACATCGCGCTCAGTCTGGCTATCCAAGAGGGCAAGTGGATCCATCGCCTGC
TGTGCGAGATTCTGGCGGCTGCCAACGACATGGGACCCGAACTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATGACCAAGAACCCGGTGAACCA
CGGCCGCGCCAAGCACATCGACATCAAGTACCATCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCGGTGATGCTG
GCGGACATCATGACCAAGGCGCTTGCGGGACCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGGCGTATTGAGGT
ATGGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGCCGATTACGCCACCGACGATTACGC
CACTGTCGATTACGCCACTGTCGATTACGCCACCTGTGGGTACAAGATTGTAGGTACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGCTAAAGTAAC
TCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAG