Description :
From Genome Similarity Track
Location :
Scaffold_1027:4725- 5741
Transcript NameFunction/comments
Phyta_totarag11799hypothetical protein PHYSODRAFT_522883

Sequence
1016 bases(100 bases per row)
ATCCTGTTGAAACGCAAACCGCTAACTCTGAACGAACTGCACAGCATCATCGTCGGCTACTACCAGGCCAAGATTTTCCAAGACGTGCAGGACGATTCCT
CCGGGAAGCCCCGCACCAACTTGGCACAGTTCATCATGGAAATGTACGTCCTGCACTACGGACTCAAGGACCTCGCAATCAGTCAACTTGTTTTCTTGGA
CGCTGCCATTAGGAAAAATGCTCACGTACGTGCGGCTTGTCTCGGATTTTGTTGTACGTCAAGTGCTCTCGACTAGATCATGAAACTTACACCAATTTTG
TGGCCACAGGAAAGCGCCCGCGTGCGAACTTTTGGACTCCTCACGGGATCGCTGGACCCCGAGTCTCATGCCTGCTCGGCTCAAGGTGTCGACTTTTTCC
TGCTGGTGGTCGTGATCATTTTCAACGGTATGCTTTCTATCATGCTGCGCAATGAAGATAATTGCCTCTCTGTTCTGACGCAGCTCTGCTCCAGCTGGCG
TGTACAAGAAGGGTAGGAAGCAAGCCGTTACCATTGCACAGAATCTCAAGACATTCTTCGGGGATGGCATCTTTGCCAGTCCAAAGTCCGTGACTATCAA
GCATGAGCTCGTGTGCCAAGCAATTGACTTGGCATTTTCGTTCACGCGGAACGAGCCTGGGGGGCCCTTAAGCCAGTTGAAAGACGAGATCCGCCAGAGA
TGCTCAGCCAACAGTGGAGGGCTGGACATTGACATGGTGCTGGAAAAGATCATGAATTACTGGTTTGTACTCTACGAGCAGCAGATTCAAGACATCCACA
GCATGTTTACGGTTGTCGATACAAATGGTGACGGCACGTTGGACTTCCAGGAGTTCTgcgagctggtggtggtacTGGAGCCGACAATGGACCGTCGTGA
TGCGCTGGCACTTTACAACCGCGCAGCTGGAGAGGACaacatcatcgacaaggacgagTTTGTGCAGGTCATGCTGGCTCACCAGCGTGGTGTCATTCTC
GAGGAGTTCTATGGCG