Description :
From Genome Similarity Track
Location :
contig_38:472460- 475229
Transcript NameFunction/comments
g8819.t1hypothetical protein

Sequence
2769 bases(100 bases per row)
ACATCTTGGTCCAAAATGGAGGAGGCAACGATCGGAATGGCCGTCAGGGCGATATTGTACAGCTGTGTTCCGCTCTCCAAGAAAAACTTCTGTCCCGAGA
ACCCGCATAACAGTGTGTACCAATATTGAGCAGCAGTGAAGAGGATGTTCTTGTAGAATATGAACAACACTAGCTGAGCCATTCGCCTGTAATTCCAACG
ACCATGCACAAGCAACAGGCGCTGCAGAAAGCGAAATTGCGCGATAGCATAGTCACTGGAGTTGACAGCTTGCATGCCCTCTTGGCCTGAAATTCCCACA
CCGACGTGCGCTTCTTGGATCATTGAAACATCGTTCGCTCCGTCTCCGATAGCAAGAGTACGAACTCCAGGTACGTACTCCTTGATCAAAGCAACCATCT
CCGCTTTTTGGGCTGGTGATACACGGCAAGCGATAACAGCTTTGCAGTATTGCGAGAACTCGGCGAGCAGAGGACGGCACGACCCGCGAAGGGCAAACAT
TAACGTCTCACCATCAATGACAAGGGCCAACTCGCGGAGATCACCTCTCGTACTGGGAGGCGAAGCGAGGTAGACAGTCACATCTGCACTGCGGGCTCCA
ATCTCATCTCTTAGCGTGCTCTCAAGTACTTCGGGAGTTGCTGCGATTTTCGAGTTGATGATAAAAAGCTTCATGTCGTTCGTTATAAGCTGGCAAGCGA
AGCCGATGTTGATAGCCGTCTCCTCCTTGTCACCAGTGAGTACCCAGATTTTAATGCCCGCACACGCCAAGTTGGCGATTGCGTCAGGAACACCAGATTG
CAATTTGTCCTCGATTGCAGTGGCCCCAAGCAGCTCCAAGTCGCACTCAATCTCGTTCATACATTGGTCAATTGCGTTTGGGAGGTCCTTCTTTCGCTTG
TCGATTTCCGCTAGGTTGTTCTGCGCGTCGTGGAACCTTGTTGCCCATTCGGCGTAATACGAACGCTCAATTTCACGAACCGCAATCGTCAGAGTCCGCA
GTCCGTCTTCAGCGTATTGGTCGATATGGCGCCGAGTGATCTCCTGGAGCTGGGAAGAAGTAGATTCGTCCTCCTTGTCCTTCGCTAGTAATCCGTAGAT
GATAACATCTGCACCTTTGGAGTACAAGAAGATCCGTCCATTTGGGTGACGGATAATCGTACTCATACGCTTTCGCGTACTGTTGAACTCGAGAACGTCC
AGCATCTCGTACTTTTGTACTATTCCACGAACTTTGACATGAGCGACACCCGGAGATCGATTTACGAACTCATATCCAAAGTAACCTGCACCCGCAACGA
GTGCTTGTTCATCAGGAGATGAAGCCGACAGCGTGATTTCTTTGGAGTTTTCATGCCGCTCTGGGATGACGGTGTGACAAACTGCAAGATGCGTGAAGAA
GGCATCAATACGTCCCTGTTGGACGGAGCCTGAGTCCCCCTTCATATCATTAAACAGCTCGGGACCATCGAAATTTACGTAAGGAACCTTGGGCCCCGTA
GACTGTGCGGTCATATCTGGAAGGGGTTTGCCGGCACGCCTTAGTGCCGCTAGCCCGATCTCAGTGGTTCCGTTTCCGTAGGAGACCCCGCCAATGGAGC
ACTTCCGGAACTCCATGACGTTGCAGGTGAGTGTTCCCGTTTTGTCCGAGAAAATGTACGAAATCTGCCCGAGCTCTTCGTTGAGCGACATGGAGCGCAC
TAATGTCGGGGTGTCTGTTTCGGGGTGGTAAATCTTGATGTCCCACTGAATAAATTGCGCCTGGAGATACTTGACCATGCTCATGGAAACAGCAAGTGAA
ATTGGCACGAACTGGTACATGAGTAGCAGATAGTAGAATAGCATGACAATCCAATCCACAAAAGCGCTGTTGTCGGACACGTTCATTTCCAAGTACCACA
CAGAACCGTTGTTCGCCTTCCAGGCCACCGCTCCTGTTGCACCTACAGCACTGAAGACAATCAAAATTGATAGCAACACAACCGTGTACCGGTTGATCGA
CCGGTCCATGGAACTCATCTTAGACGGAGGCGCCGAGTTGCTCATCATAATCTTCGTGTCCTTGCCGGTGTTGAAAACCATACCGTGCACCCAGTCGGTG
TTTCGGATGATACAGCCACGCAGGATGATACTTTCGTACGGGATGGAAGCGTTCTCCTTTCCTTCAAGCTCCAGCACACCCTGGAAACTGTTGATTGCAT
TGTTCGGATGTTCGCAGCGGATGGTGCCTTTCATCTTGACCAAGTTATCAATTGAGCCCATATCTGCAAGAGTACACTCCATTGCTGATCGGACTTTCAT
GTTGGTCTCTCCATCCAAAGACTTGGTCTCGACGTAGCAAATTCCACACGGAGGCTGATTAGGAATTTCACTCACGGCGAGCACGAGCATATCTGCCGGT
ACCAGTCCTCGATTCACCACCTTGACAACGTCGCCTACTACGACATCGGCCCACGTAGTTGGAGTGAACTTCTTCGATGCACGGTCTAGAACGAGTGTCG
GACTCGCGTTGGCAACGTTGTCAGCTTGGTGACGCTTGTGGTCTTCGAGGATAGCAAACACGCCATCGACGGTGATGATAAAGAGGAGTGGGGGTAAGGT
GGAAGGCTGGCCGCCGGTGTTACTGATGTCAGGGATGCACTGCAGGATACAGATGAGGAGGAAGTAGAGGTTGGAGAGTTTGCGGAAGCTCTCGAAGAGG
AACTTGGGCAGGAAGCTCGCCACCGTGTACTTGGACGTGACGATGAAGTTGTTGCAATAGCCGGCTTCC