Description :
From Genome Similarity Track
Location :
Scaffold_7:4724- 6214
Transcript NameFunction/comments
Phymu_g511hypothetical protein PHYSODRAFT_491362

Sequence
1490 bases(100 bases per row)
GCAGGATCTACGATGCGACCAACGGCGAGTCGCTGTTGATAGGCGATGATGCGGTCGTTCAGGCACCCCTCGCAATGCAGCTTACgaagcgtcttgagca
cAGCGTTGGACCCCATTGACGGTACACCTCGTGTGCTCAGGaacgctgcgacttcttgcGATGCTAGCTGTCCAAGCTGACGAACAATGTCCTTGTAGGT
GGGTGCTGAATCATCGAGTGTGTACCCGTCTTCGATGAAGAGCCGCATGAAGGCCACAAGTTGCTTGGAGTCGgacttcttgtgcttgttcGTGCTGAGC
CATCCACGCGGAACTGCCGTATACCACGCGAACCAGGTATCCACAAGCGGTGTCGTCTTTGATCGGCGTCGGCGCTTCACCGGTAAGCTTTCATCTTTGT
CTCGTGGTCGCTTCGCTTGATCATCACGTGCTGATGTGTTATCTCCAGTGTTGGTGCTTGTAGCTTCTAGCAAGTTGACTCGAGCCTCAAGGTTCCGGTT
GACCTCGATTAATCGTTCAATTAAGGCAGTCTGGTGATCGAACACAACTTTGGCCTTTGCGTTTCCTCCCATCAGGTCGTCTGCNGACTCCGCATTGAAC
TCCACCAACGACGGGTAATGGTGGATGATGGTTGCTGTCAGCACCTCCCTCACAGTACCACTAAGGTTGAAGGCCTTGTCGGCGAGTGCATGGCTAGCGT
TGAAGAGTTTGTAACTCATTTCTCTGATCTGCTCTTGTGTGACCGAGTCGAAGGTATCCAACGACGGGAGAACAGAGACTTGTCGCGGAGACATTCCGCT
CAACACCTTCGCAACCTGGTGGTCTTCTTTCGGGgtgttgaagacgtacgcAAAGGCTTTGTTCGTCGTGGTCAAGTTCCAAGCTCCACGATCGAAGATC
CACTGCGCCGTCAGTTCTGAGCAGGCATTCGCATGCTGCGCACCGCCACGTCGAAACGAGTGAGAAGTCAGCGCATCCTCGACTCCAGCCGGGCGAGCAA
CACGGTCCAGCAAGCGATTGACGAGAGCGTGGATTCCAGCTACAGGTGTGGCGTTTGTGGCGCGGCTGGTTGATGGCGCTTGCGAGGAACCCAGGATGCT
GCTGTCATCAAGCAAGTCCAGAAGCGGGATGGACTCGCCCAGCTCGACAGGTACGTCCTTCGACTTCACCGGCAAGTGGTTGAGAAGCGCAGCGCAAGGC
GACTCCTGCGTGATCAACGCCAGTGCCAGGGCGACCAGCGNCggatgaagcggatgaagaacacgccacctgctccgatggagagctgctgcttccgaaC
GAAGGTTAGATCCGATGCACGTCCGAAAAGGTACCAGAGAAggcacagcagcgctgcatcttggtAGTCTGACCCACAGCTGGCCGTTGAATACAGATAG
CTTGTCATTTTCTTGAGACTCTCCTTCGTACACGCAATTGCTTTCTTGACAAACCCACCACTTTCGCGCTTGATAcagtgctgctcaagc