Description :
From Genome Similarity Track
Location :
Scaffold_1051:4724- 5917
Sequence
1193 bases(100 bases per row)
TAAATTTCGCTTCTTACGTCGGCGGAGGGGTGTCACCAGTACCACGCAGCGTAGGCAACTCATTTTGCAAACCACCAACGCCCCAACCGCTTCGGAGCAA
GCCCACTTTGTCGCGCGGCTCGGTTCAGGACGTGGAAGAGCTCTTTGACCTGTTTCCATACGACGATGACTCGCCCCAAGACGAATCGGAACGCGGTGCT
GAAGTTGGTCGGGCAAACACTACCACACAACACGTGACAAAACGACAGCAAGAGGTCACGGTTGCCAACGGCGACGATGGCCACGTCCCCTCCAAGCGAC
AACGAGTTCAAACCGCTATTGATCAAGACGCGTTGATTATCGCAAAAATAAGCGACGAACCGGACCTTCTCGAGCGTTTCATGATGATTAGGAAGGAGGC
CAACGTCAAAGCGCAGCCGGCGGAGGGTGGTGGTACCATGCGTACTCACGTACAGAAGCCTTTCCCTACGACAAGGGGAAAGAAGTCGTCTAAGTACGCA
TTTGCACCGTCCGAGGAGCAGGAATTAGTTCACGAGCGCATAACAACGGAGAAGCACAAAGGTAAGTCTGCCAATGTGTTTTGCAGAGGTTTAGTTCGGT
CCGAGCACGTGGAGTTCAAAGCCGTACCTGGAATTTGTACGCGGGCCTATGATATTCGTTTCGGTTCTGGTGGTCTTTCGATTCGACACTTTGCAAGACT
ATCGAGGGATGAGCGGGTGGCTTGGTTGGAGGCCGGTGGTTCAAACTTTGACAATTTGTCCGCAACTGCAGAATTCTCGGCGGCATCGCCGGCATCGCGC
ATCGAAGATGTTGTGGACTCTGCCAGGGTTTTCCTCACCTATGCTCGCGAGTTTTGCTGTGCTGAACTGGTCGAATTGGTTGAGACCATCGTGAAGTTCA
CCGAACACACGCTATCGCAGGTATCGTGGACGCCAAAAGAGATTTCTAGCTTAGTTTTCTGGGTAAATGACGTTCTCGAGGATTTGCGTACAGCAGCTGA
GGAAGGTGGTGAGCTTCGAGCCGTACAGCAACGTTGTACGACCGATGACCGGTTGCTCAAAGATGTGATGTTTATAAAGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN