Description :
From Genome Similarity Track
Location :
scaffold_77:47233- 48365
Transcript NameFunction/comments
Pl_110344poly

Sequence
1132 bases(100 bases per row)
TCACTTTTCAATTTACTGCCAACGGGAACAACAACAATGGCTCCTCAACAACAAGATGTTCAGACATCGGTTCCTACTAATGCTGTGCCTTCCGTCGTGG
AGAAGACTGTCCCAATAACCAAGCCTAAGCCCATCAAGAATGCGCTCAATGAAGAAGTAGAGCACTTTGAGTTCGAACACCCGGAACTTCGGAGTGTGTA
TCCCACAACCAAGTACGACCCAATTCCAGTGCTGCCGTACGAGGACCGCGCTTTGAAGGCCGACCCGACGTTCAAAAACTTGCTTAAAGATGCCACGGTG
ACGCACTTGGCGCCGAAAATTGGCACAGAGCTGTCGGGTATTCAACTACACGAGCTGTCGGACGCACAAAGAGATGAACTCGCTTTGCTGGTGGCACACA
GAGGTGTAGTGTTCTTCCGTGACCAAGAGATTGGCATTGAGCAGCAACTGGACCTTGGTCGCTACTACGGCCCTCTGCACATTCACCAAAACCTGGGCCA
TCCTGAAGGGCACCCAGAAGTGCTGGTGGTTGAAAACTCGGTCGAGGACAATGACCGCATCATTAAACGCCAACAGTTTGACCCCGACAATGTGTGGCAC
AGTGACGTGTCGAATGAGCGTCAACCTCCGTCGTACACGAGTTTCAAAGTGTTGACGAACCCTCCCCTTGGAGGAGACACATTGTGGGCCTCAGCATACG
AAGCTTATGAACGCCTCACACCACCATTCAAGAAATTCATCGAGGGACTTACGGCGATTCATAGCAGCAAGGGCCAAGCCCAACGCGCTGAGAAGCGTGG
ACACACGATTCGCCGTCCTCCGGTGGAGTTTGAGCACCCCATTGTGCGCACGCACCCGGTTACCGGTCGTAAAGCTCTGTTCGTGAACCCTGCGTTCACC
ACACGCATCCCGCAGCTTTCATCTCGCGAATCTGACGCGGTGCTCAAGGTGCTGTACAAACACATTACGGAAGGCCACGAATTCCAAGTGCGCTTTCGAT
GGACCAAGAACGCCGTGGCCGTTTGGGACAATCGCATCACCGCTCACTACGCGACGTTCGACTACTTGCCGGGTAACCGACATGCAGTTCGAGTGACTAC
GCTAGGCGAGATCCCCTACTTCGACGACGACG