Description :
From Genome Similarity Track
Location :
Scaffold_134:47232- 48994
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_134-snap-gene-0.34Inositol oxygenase

Sequence
1762 bases(100 bases per row)
CTCACCACTGAAGCTCCTCGGGAAGATATTTCTGAGCGAGTGCGAGGTAGTAAGGCATCAACCGCGGCGGGTCCACCGACTTCATGCGTTCCTTCGGCGC
AGCCGCATATTGCGAGAGAAGTAGCAGCCACTCCTTTGTCTCGGCGTCCTCGGGAGAGCAAAGATGCTCGTAGCAGTCCTTCTGGTACCATAGCCGCAGA
GACCACAGtcGAATGGCCTGCATGGCCTCCGACGGTAAAGTTGACTTGTTGAACTCGAGCAAACGGAAGAGGTATTCATCGGGGGTCCACGGTAGCAGGA
CCTTTTCAAACCCGCATCCAGCCGCGGGGGACTTTtCTGGCGCACTGCAGTGGTCGCTGTTCAACAAGTTGAGTTCTGGAAAATCGATTTCCTCGGGAAT
GCGCTCGCCAACAACCCACGTGGACGCGCGTTGGATCCATTCACAGGGCGAGATCGAACGCAAAACAGCCGTCTCCTCGTCCGCCCACAGCATGAAAAGC
ATGCCAAGACCTCGCCTAAAAGAAaCAAACAGCAACGTAAGCACCACCACCAACTGTGATAGCgAaCATTtGAAAAGAACTCACAGAAAGAGGACGAGCT
GGAACCAGTCGGGATGGCCATCCTCACGAGCGGCCTCCGCCGTGGCAATGGCGTTGTGTAGGAGCCAGCTGCGTGCTGGTGCCTCGCTGTCGCCCGTAAG
GACCATGAgaGCCTGGTAAGCGTCAGCGATGGACATTTtGGCATGATTGAAGCTGCCGTACTTtGTGATCTGTTTCTCCACGAAGGCCTTCGTCTGGTAT
TTGCGCAGTAGTTTCACGTAgAGTGGTGTGAGATCGCTCTTGTTGCACACGAGCGATTGGATGTCATTGCCGCcgTCCcAcGgCACCGGCTtCCTCGACG
CCACCACCTTCTtGGTCGTTTCGTCGATGCACAGATAGCTACCGTGAAAGTCTTTCAAAGCGACGCCACCGCTGCTgaTGATGCTTTTCTGCGCGACTGC
TGCGTCCTCgaCGGCCGCATCGATCGCACTCTTCGTCtCTTCAGTCACTGGGTGGTCTTCGTGGAAAGGAaCAACTTGGAACGTCTCCCAAGTCGAGTTC
CACGGGCGATCTGCCAGCACGGCGCCGCTGTCCTCGACGCACAGGAACTTGCCATGCACGGACCGGAGGAAGATCTCTCCGTCGGCGCCCAGCAGCGTCT
GCCACATAGCGTCGGCGCTCGCGTCCGAGTCCTTGAGGCACGCGGCTTCGATTGCGCCGCTTTCAGACGCCACGAGACACGAGCCGTCCTTGGTCGCCAG
GCGTAGCATGCAGAACCACGTCTCACGACGCGGAGGAGCCGGGAAGAAGTCTCTCGCGTGGCAGCTGAGCGACATGGGCACCTTGCGGAAGCAGTCATTT
TGGTTGTAGAGGAACAGCACCTTGGCgTCTGCGACCTCGCAAAAGCCCCAGCGCCGGTACATGCCCACGAGCTTCCCGTGGCGTCGCGTGTCTTCCTCGG
CTTCCAaGTTCAGTGTCTGCACGCGCAACTCCGCAAGCGTGGACAGACACGCCAGGTAGAGCACGCGCGCGAGCCCAAGGCCGCGGCATTCCTTGTGCAC
GGCGATGCTCTTGACGTGCGCGCTCTCGCCCTCGCGCTCGAGCGTGAAAATGAGTTTGCCGACGGCGCCACGCCGCGCCGAGGAGAAGAGCACCCAGCGC
ATCTCCTTGGCCTTGACGTCGTGCGCGAACTCGAGCCGGAACTTGGGCGCCAGCGCCACAGC