Description :
From Genome Similarity Track
Location :
Scaffold_252:4722- 10247
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_252-fgenesh-gene-0.2FKBP-type peptidyl-prolyl cis-trans isomerase
Pytiw_DAOMBR242034maker-piw_contig_252-fgenesh-gene-0.5Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_252-snap-gene-0.17Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_252-fgenesh-gene-0.3Mediator of RNA polymerase II transcription subunit
Pytiw_DAOMBR242034maker-piw_contig_252-fgenesh-gene-0.7Late embryogenesis abundant 1

Sequence
5525 bases(100 bases per row)
AAGCAGCAGCAGACCACACAGCTAGCAACATGTCGTGGCAGTCGGTGGAGAACATGATGTACATGTCGTACTTCCTGGCGGCCAAGTCCGTGCCCGTGGT
GGCTGCCGGCGCCTCCGTCGTCTTCGCCGTCTCGCCATGGTACGTTGTGACAATGCGCCACCGCCTCTTGCTGTGTATCGGCGGCTCTCTGACTGTGTGA
CGCTGCTGCTGCTGATGATGATGACGGTGGCTTCAGGCAGACGGTCAAGACGATCCAGCAGGCCAAGAGCACGCTGCAGTACCCGTTCGCGCCGTTCTTC
TTCTACTTCATCCAGTCAGTCATCTACACGCTCTACGGGTTCGTGACGTCGAATCTGGTCATGGGCGCCACGGCTCTTCTCGGTGTGCTGTTGGGCTCCT
ACTACGTGTACGTGTACTACACGCACGCCGGCGACAAGACGCAGCCCACGCGCATGCTCACGTACTCGCTCGTGTTCATCGTGCTGCTGTCGCTCGCCGT
GTCGCACTCGCCGGCCGAGTCGCAGCTCATCATCGGTGTGCCGGGTAACATTCTGTCGGTGCTCACGGCGGCCTCGCCGCTGCTGCAGGTCAAGTCGATT
CTGCGCCTCAAGGACGCGACCTGTTTGCCGTTCGGCATGTCGGTCATGACGGTCGTGGCCGGCGGCATCTGGATGGTCTACGGCATCATGCTGCAGGACC
CGCTCGTGATTTTCCCCAACCTCTTTGCGCTCTCCATGGGCATCATCCAGGTCTCGCTCATCATCCTGTACCCGGGCGCCGCAGTGACCGCCAAGGTAGG
CAAGAAGAACTGCGCGCTTGCGTCGCCACCGTCGCCTCATGAAGCTGCTGCGCGAGCGAGAGCAAAGTCTGCACACGAGAAAGCGTGACTGTGAGTGTCT
GGTGGGTTGTGTAAGTGGCAACGAATCTGATGGGTGTGGTCGTGGGCATCGCTGTCACCGTGACGCTTGATAAAGTAATAATGATGATGTGCTTGGACTT
GAAGTTGCAGTGACGGACGACGAAGGTTGTTGCGTGTCAATCATTCGCTTTGACCTCCAGCACCTTCGGTCCGACAAAGAAGCACGATCAACTTGGTATT
TTTGGCCGCCGTCAGTCGTTTCGCTTGAGATGCTCGTTCTCGTAAATGCCAAAGCTCAAACACAGCATCATCATCACATACAGACATTGCAATGGAAGCA
AAGGACTTCATCATCACGAACCCGGTATGCGTGTACGTCCTGAAAGCACACATGCTCCGCCTTTGACCAGTTAATCCATGAGGCTGTGATCTGTGTAGCG
CATTGGGGAGATCCAGGTCGAGGTCTTCGTCGCGGGCGACGGCATCAACTACCCCAAGAAAGGGCAAACTGTGGTCGTTCACTACACTGGATATGTGAGA
ATGCATGAGTCCACATGACATACTCAGAGAGAATAGCATGTGCTTACCTGACGTAGTCAATTGCTCTCGTGCAGCTCCAAGACGGCAAGAAGTTTGACTC
GTCGCGAGATCGGGAGAAGCCGTTTAAGTTCAAGCTCGGCGCTGAGCAGGTCATCCCGGGGCTGGACGAAGGCGTCGAGCGGCTCTGCATGAAGGAACGC
GCCAAGATCTTTATCCCTGCAGACAAGGCCTACGGACGCAAAGGGTTCCCGGGACTCGTTCCGCCAAACAGCAACCTCATATTCGATTTAGAGTTGCTCA
CCTTCCGCTAATAGGCCTCGCTTGATACAAAATGGTTCTTGGTCATTGTGATCCCTCGAAAAGCTCTTTTTTCTTGCGCTCAAACTCCTTCTTCCTCACG
AGCTGGGCCTCTCGCGCGTCGAGCTTTAGTTGAATCGATTTGATCTGCGTCATGTGCTTCTTCGCGGTCAGCTGCACCTTCTTCTCGTCTTCTTGTAGCT
GGGCCGTGAGCTCGTCATATTGGTACGCCACGACTGGAAGCGGTTTGCTGAACTCCTGCTTTATCACCGCGTGCATCCACTCGCGCTTCTCCTTACCCTC
GGTCTTTGATGCTCGAAGGAACTCGTCTCGATCTTGGAGCTGCTTGCTGAGCCGAATCGTTCCCTGGATTTGCCGCTCATTGCACACTTTACGCCAGTTC
AAATGCGCGATCTGCTCTTCCAGCGACGCGAATGAGGAAATTGAACCGGACGGACTCAGCATGCTGTAGGTGCTCCTCTCCTCACTCAGTTGTTAGTCTA
CTTCGCAAGACTGGGTGGGACGAGTGCTTCGACTGGTGTTTGGTGCGGATGCAAATACTCAGATGGGGTCGCGGGTATTTATGGAGCTCGTCTTCTGGAA
ATTATCTGCGTCGAGCTGAGAACACCAAAGCATCCTGAATGTCAATTACGTGCTCCGGAACCACGAATGATGACTTGGAGAGCAAAAGTCACAGATATCA
AAAAGACAGAGCAAAACTCACCGCAGCGAATTAAACGGTGTGGACAGCTCAAATCGCCCCTGAGAATCCTGCAATAGGCTTGTCAAAGGTGTACCAAATC
AAGTTTGGAGCATGAACCAAGTTCTTTTGCTGGAACCACGGCGCTGGATCTTGAACTGCATGCGCTTGGCTTATTTGCTTCTCCTGTCGTGTCACTTCGA
AGTCCGCCTCTTGCGGTGACGAAGGAGACGACGAAGAGATGACCTCCAGTACTGGGCTTGGTGCAGGGTTGCCTCCTCTGACGCAGAAGTGATGTGTCCG
ACTGCTTTCTTTCGGCAATCGGAGTCGGAACGACTGCTTTGGCACAAACCCTGGGATGCTCGTTGCTCGCCTCTCAGCAACAACTGCAACATGCAGCGAG
GTGACTGCGAGAACACTGGGAAGGAACAGCGATTACAAAATACATTCACATGTGAGGTTGATGACATAGTCCGCGTGAAAAATAGATGATAAAACCACAC
AACATCGTACCTCCTAAACCGTTCAGTGCTGCTTGCGATCACAGCTCGAATGAGCTTCTGGGCACAAAGTCGTAACACTTTCTCTTTCGGCAGCTTGGAG
CCGGTTCCATCGCTTGGCAAAGACTTTTCACAGTGAAAGTCGATCACGAACACTTCCCGTGGACTGGAAACGGAGGCACCGAAGATGAGCACCACTGCCA
TTCAGAAGACACGGTGTCAGTCAGCCATTATCTTGTGAAAACGACTTCGTCGCCCACCAACTTACCAGACTGCACGTCTCGTTCAAACATCGCGCCCAAG
TTGTCCTGAAACAATCGCTCGGTCATGCTCACACACTTGATAGCCTTCTTCATCGGTCCGCTCGGCGCTCTCCTGCACAACAACATCCCCACGGCTCTCC
ATTAGCACATATGGACACACGCAGGAAGGGCTGACACCTAATCTGAATACATTGGTACCTTCTGCGCTGACCATCTTGACTCTGCAGTTGCATTTGCTGC
TGGTATTGACGCTCCAACACGATGCCCAGTAGCTCATCATACACACTACGCGCACACATAATCCATAAATTAACACGCCAGAACAACGTCATCACTCACA
CAGCCGATAGTACACACACGCAACAGAGAGCACACGTGGTCTGACACGCCTTACCATGGGATCTGGCCGCGAAAGTAGAGCAGGAACTGCACCAAGTGCG
TCACGAGGGCCGCACAGATCGCCCCGTCGATCGCCACTCTGTACGCGATGCGCAGCGGCGGAAGCGGCGGCGCCACAGGCATAACAGCACGCTTCCTCTT
CAGTCGTCTGCTGTTGCTGCTGATGTCGCGAGCCTCGTCGACGCCTTCGCCTGCGGTCGCGCACGCCGTCGCCATCGTCGCGCATTCCGCATTCATTAGT
TTCAAAAGCGCAACTCACGCATTTCTAGGTTCGCATTCGCTAATATTGCGAACCTAAACGTCACAGTTCTAAAGCTGAGTTCGTGTCATGTTAGTGACGA
AACCTACAAAAGACACAGCACGAAAAAGCCCAAAGAGCTGAAGAAGGGCAGGACGATGGAGGTGGCGACGCACGTGGACGACTACAACGGCTCGTTCCGC
GACACGATGTGGCTGCAGTCGTTCCCGCTCAACACGCAGACGGTGATCCACTACTTCGCGCTCTCGCCCTTCTACGACCGCTCGTGCAACAACGAACGCC
TCAAGATGCAGCGCCTGGGGCTCGACCAGCTCAAGAACATGCGCGGCATCGAGTACGAGGTGCTGCCCAACACGGCCAAGCAGCTCCCGCAGCAGCTCTT
CCTCATCCGCAAGCAGCGCCGCAGCAGCCGTACGCAGGTCGAGCCGCTCGCGATCTACTACGTGCTCGACGGCTCGGTCTACCAGGCGCCCAACATCCAC
GCCATGCTCACGTCCCGGCTGGTGCGTCTTGCTTATGTATATCACTTGTCATGATACGACCTGGGTACTCACCTGCTTTCTGTGTGCACATGCGCAGAAG
AAGTGCAGTTACCGCGTGAATAAGGCGTTCCACACGCTCGCGGCCGGCGTGCGCTTCAGCCCGACGGAGGGCTACGCGTGGGACTTTAGCTCCGAGGACA
AGAAGGAGCCGATCATTCCTTCCGAGCGTAAGTGTTTCTCTTGTAGCGGTGGTGCGGATGTTGATTGATGTGAGGCTAATGTGTCTTGTCGTTTTTGTAT
TAGAACTGCAACTCAAGCTCAAGCAAAAGTACGAGAAGATGGAGAAGCAGCGCGAGCACTCGGCGCGCGTGGACTCCATTCTGATTCAGCTCATGAAGAA
GCACGCGCCCGAGATCGCTGAGAAGCTCGAGGCCGAGAATGCAGCCAACAGCAGGGCCGCGCAGGCGAACCCGAGTGGCGGACCTGCCCCCGCAGCAGCA
GCACCAGTCCCAGTAGCTGGCGGCGCCAAGCGTGATGCGGATGCCACGGACGCAGCAGCCAAGCGCCAGAAGGTGGCGTAACGTGCATGATGTCTTGCTC
AGCTGAATAGCATGCAACACATTCTTCTTGTTTTCTTCAAATGGAATTGTTCAGGTGTTAAAAGTATGCAAAACGACTCACACATCTCAAGCGGAGCCCC
CATGATACACACACAGATGCCTCATCTCGCTCATGCTGGCGTTGTCTCTCCTCGCTCTTCATCTCACTTATCTTTCTTGCTCATGAGGTTCTCCTTCGTG
GCCTCGGCCTTGTGCTTGGTGGCCTCGGCGTAGTGCTTTGCCTGGTGCTTCGTGGCCTCGGCCTGGCTCTTGACCTGGTCCGTCTTGCGCTCGTGCTCGC
CCTCACGGAGCGTCTCAACGGCTTGGTCCTTGGCGCTCTTCATCTTGTTCTCGAGCGCCACGCGCTTGCTCTTAAGCTTCTTCATGCTGGCGTTCCATCT
TTCCGGATTGCGGCGGCGCAGGATCACCAGCGCGAGCACGACCAGCAGCGGCACGATCCACAGCATGTGGCGCGCACAGACGCGACCACCCGCGGGGAGC
GGCAGGCAGTACTCCTTGTCGCCCACGACCTTGGCAGTGTCCGCATTCTTGTGCCACGTGTCCTCCACGCGGCCGCGAGCCGAGCCCATCGTCTCCTTCA
AGCGCTCCTTGGCCTCTTCCATGCG