Description :
From Genome Similarity Track
Location :
Scaffold_186:4721- 7086
Sequence
2365 bases(100 bases per row)
TGGGACTCCCTACGATCCAACCCCTATTTCGACCTCCTCCAAGAATTTGAGGACGTCTTCCCCGACGAGGTACCACGTCGACTCCCAGTCGACAAGGGCG
TTCAACACGAGATTGACCTCGTGCCCGGCGCAAAGTATTGTGTCACGTGGTAATGGCCGCTTCCTCGCGACCAAGTCGATGCCATCGACGCATTCTTCGC
GGCCCGCAAGGCGGCGGGTCACGTCCGCTAGTTCATTTCACCTTACAGCAGACGGACCTTCTGTGTGAAGAAGCCCGGTGGGAAATGGCGTATTGTACAC
GCCTTTAACAAATTGAACGCAGCCACGATTCCGGCTCAGACGCCGATTCCTCGCAAGGATGTTATTATCGACGGCATGGGTCGATCCACCACTTTCTCCA
CCATCGACCTTCGCGATGGCTTTTACCAAATCTTCATGCGTCGATGTGACGTCCCGAAAACGGCGGTTTCTACGCCGAGTGGCATGTTATGGGAGTGGCT
GGTCATGCCACAGGGTCTATCCAACGCCCCGGCGACGTTCAATCGTATGGCCACCGCGAAGTTTCGGGCGTTTCGCGACTTCGCACCGTCGTACTTCGAC
GACATTTACGTTCACAGTTGCGCCTCCTCCGCGCAATCTGATCTTGACGTTCACCGCGGCCACCTCCGCAAGGTGCTCGAAGTCCTCCGTGCCAACGGAC
TCTATGCCAACCTCGCCAAATGTATGTTTGGCGTTGACAAAATCCCGGTCCTGGGAGATTTAGTGGGGGTGAGCGGATGTCGGGCTGATCCCGAAAAGAT
CAAGGCCATTTCGGAGTGGCCTATTCCCTCCTCCGTCAAGGATCTTCGTCACTGGCTAGGTCTTGTGACGTATCTACACAAATATTCGAAAACAATTGCA
GACATCGCTTCAGCCATTGTTTCGGCTTCTCCTCAAGGACTCCCCTTGGGTCTTGGGACTCCACATGTCAGAAGGCTTTCGACGGCCTCAAATCCAGCCT
ACAACGCGCCACGATCTTGGCGCTCCCGGACTTTGACAAACCTTTCTCCGTCGTCTGCGACGCCTCGCAGTTTGCAATTGGCTGCTGCCTGATGCAGCTC
GACGCCTCCGGTCGCCCTCGCTCAGTTTCCTACCAAAGCCGCCAACTTCACGCGGCTGAGCGGGCGTACCCAGTCCACGACTTGGAACTTCTCTCCATGA
AGTACGCCCTAACCAAGTTCCGTATCTATCTCCTCGGTGGTTAACACCGATCATGCGTCCTTACGCACGGTGACAAACACACCACACCTTTCGCAGCGCA
TGGCGCGCTGGATTTCATTCTTCTCCGAATTCACATTTTCGGTTCAGTACAAGCCCGGGAAAGACAACATCCTGGCCGACGCACTCTCTCTGCGTCCTGA
TCTCGAACTGACTACGATCGGTCTCTTAACGTCGGGTCTTCATGATCGAATTCGTGCAGCGTACCCCTTTGACGCTGAATGCTCGTCGCGCTTGGCGGCG
CTCATCGACCTATTTCCCCCAAACCCCGCCGTGCTTCGTCGGCCTTACATCACTTCGCCCTCGCCGATGGGCTTTTGATCTTTCAACCCACCCCGGACTC
ACCGCCGCGCATTGTTGTGCCCGGTGACTCGCAGCTGCGCCTCACTTCCTTCGATCCTACCATGACTCCCCCAGCGGCGGTTTTTTCGGCCACGACAAAA
TGCACGCGGTCCTGGCGCGTTCATACTGGTGGCCCCGCATGTACAAATCCGTTGTGCGCCACGTCGCTCATTGCGACGCTTGCCAGCGCACTAAGATCAC
CACCTCCTCTCGGGCCCCGCTCCAACCTCTGTCCATTCCCGACGAACTTTGGTCGTCCGTCAGCATGGATTTCATGTTTGGCCTGCCACGCGACGCCCGC
GGCAACACCGGCATTATGGTTTGTGTGGACCGAGCGTCGAAGTACGTTATTGCCGTCCCCGTCCGGGACACGCTGAGCGGCGCGGATGCCGCTCGCCTCT
TTTTCGACCACGTTTTCTGTCGTTTCGGCCTGCCTCGCTCCATCGTCTCGGACCGCGACCCACGGTTCACGGCGAAGTTTTGGTCCAACATATTCGCCCT
ATGCGACACCTCGCTCGATATGTCGACTTCGGACCACCCCGAGTCCGACGGCCAAACGGAACGCGCCAACCGCGTCCTCGAAGATATCCTTCGAAGCTAC
TCCGTTTCTACCGGTTCCTCGTGGGCTGTCAGGTTACAGCACGCGGTTTTCGCTTACAACGCCTCGGTTCAGGCATCCACTGGCTTTTCGCCGCATTATG
CGGTCCATCTCCAACACCCCCGCCTCCCTCCAATGCTCGACAGTTCGATCTCCAGTGGGGGTGGA