Description :
From Genome Similarity Track
Location :
Scaffold_1301:4721- 6093
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1301-fgenesh-gene-0.2Drug/Metabolite Transporter (DMT) Superfamily

Sequence
1372 bases(100 bases per row)
CTTGCCCGCTCCATCACGGCCGAGCAGACGCTGCGACGCACCGCCCGCACTGCGCGGCGCCATGGGGCTCTGGCGGTACACGACCTTGCCGCGGCGCTTC
TTCATGAGATGCGTCTTTTGAAGCGATGGCGACGAGTACATGGGCGATTTTTCGACCGACCGCGCGCCGCTTTCGACGAGCCGTTCTTCCTTCTCCGAGT
GGTACACGAGCATGCCCATGACCAGCACAAAGAGTGCAAAGCCGTCGTAGATCGTGAAGCTCTGGCCGGCGAATTTGCCCGTGAGCACCGGCACCATGTA
GAGCAGATCGGTGAGCGGCAGGCACACGGCGGACGACACGACAAACAGGACGCTGCTGCCTTCCTTGAAGATGTAGAGCATGAGCTGGTTGTACACCATG
TTGAAGAAAATGTACACGAGGAAGACCTGGAAAATGCCCGCGTCACACGCGAGCTGCTGGCCGTTGAAATCGACCCGTTCGCCCATGAAGCACTGGTGGC
CCTTGGCGACATAGTCGCCCAGACCGCTCCACGGAATCGGAGGGTCGGCAAACGCCTTGATGCGGATGGTCCAGATGGACGCCACGCCGAGGATGAGCTG
ATAGAAGCTCACCCAGGCGTTGGCGTACCAAATGTCGAGGTCCACGTCCTTGAGGCCAATCTCCTTGTACACGTTGGACGCCGCCGCCGGCACGAGGGAG
ATAATGTAGAGCGCGATCCACCCGACCGTGGGGTCGGGCATGTTGCTCGTGTCGGCGCCGGTCAGGATCGGAATCATGTCGACGAGACCGCCGTACAACA
CGAGAATCGAGCCGAGAATGTGGCCGCGTTTGAAGCGCGTGGAGAGGAACACGTACGAGAGCACCATGTTGAACGGCAGGTTCAACTGGTTCAGCACGTT
GGCAAGGTTCCCACTAATAGCAAACGCAGCGTAAAAGTCAGTTTCGATATAGCTGCCACAATGCCGTTCTCTAGAAAGGCAAAGCGTACCCAATGTGCGG
AGTCGGGAACGCGCCGAGCATGTTGTAGAGTGTGTCCAGCAGCGCCATGATCGCGTACTTGTAGTGCGGGAACGCGCGCATCTCGGGCGTAATCTCGTCC
GTGAAGTACATTTTGTACCAGACAACGGGCCACGTCGTCACGACGAATGCAATCGGCGTGATCACGTTCGAAAAGTACCAGAGGAACGCCACATAGTCGT
ACGTAATGCGCCTGCAGAGATGGAAATGCACGCGTCAGAGCCTGTGTCCCTCCCCATTCATCACATTCCCCCAAGCAAACGCACGTGTACAGCACGCGGT
CCACGCAGCGTGCAACAATCAGCAGCACAAGCGCGATGGCGAGCTTAGACTCCCAGAGGAGCCGCTTGATGT