Description :
From Genome Similarity Track
Location :
Scaffold_28:47204- 50875
Transcript NameFunction/comments
Phyta_totarag1499hypothetical protein PHYSODRAFT_327114
Phyta_totarag1500calcium-activated potassium channel subunit alpha-1, putative

Sequence
3671 bases(100 bases per row)
ATTCAACCCTGCGATATACAACTACGATTTCCTGAGCAACAGATACCAGGGAATCGTTGCCGATACTGCGTATCACAGCGCTGTACTTGCCGACTTGGAG
CTCGTGGTGATGGTAGTTGACTGTACGTTCAGGCAGATTCTAGTAGGAGACCCGTCAGTAGTGCGAGTATTCAACTTGGTACGCTCACGAGCTGATCCAA
GCGAGTTGTATTTGGTCATAATGTCGCTGAATGTGCAGGAATACGAGGTGCGCGACTTAAAGAAGAAAGGTCCAGCTCTAGTGGGTATGCTCACCTTAGT
ACAAGACATCCAAGCGGACAACGTGGAGCAGTTCTACATGGTGGCAAAAACGTATCCGTACGAGCGCTTACCAAACTTTGAAATGTACGAGTTGGTGGGG
GTAACAAGCGAGAGTTATCTGGAGCTACGTAACATTCCTCGTGATCCGTTAACGCATCCTGTCAAGCATTTGCTCACTGCACGGAAACGCGGTTTCTTCG
ACGGTGACAGCCAGGGTAATGTTCGCGTGATGTACTCAATACTAGAAGGGCTAAATGCGAAGACCGCGCTGACACGCTGGGAGTGGATTGGCAAAGCCGT
GACGACGGACTCGTGGGCGTGGGTGCACTGCGttcacttcttcttcggcttaCAGACGATCTATTCGTTACTTGTGCTTTTTCTCGTGACATACCAGAAA
ATTCGCTCTGGCAAAGTTTGGATCGGTGATCCTTTTTCGTCGGTATCGACTACCAGTCTTGTGTTGCGTGGTATCCTAGTACTGATCACGTGCCTTATAG
ACAACTTTTGGTCAGTCAACGAGTACGCAATGTCCAGAGCCTCAATCCTCACTGGCTCGCAAACGGTGCGAGTTCACAAGGAGATCATGCATGCTGACGT
CATGGCGATAGTTCTCAGTTTGGTAGGCTTTATCGGCTCTATCTTTCGTGAGCGTATCGACCCATCGATTGCCATCTTTCTGTTCGAGTTCATTCACAAA
TATCGATTGACCTTGCTACGCACTTCATCAGCGGTGGTGGATAATGTTTCGACCTACTCAGACAACCAGTGGAAACTTGGTGTTGCGAAGGTAAACCCcg
tggctgctgccatgTCTCCGATGCGCATGTGGTCGTCCTTCCAGTTTCCTGGAAAGGATCCCGTCTTTATCGTCGCTTCTTTCTTCCCCACGACATACTT
ACTGGTAGGGGTCTCGTCTTTCGCCATTCTTCGCAAGATCTATAAGTACCGCAATCCGGACAAGGTTCACACACGATCAAGGCAAAGCGCAGATACATCC
GGGAATGAGAAGGCCGCGATGAGCTCGAAAGGGATCGTCACCAATTTCGAAATTTCGACGGGTGCTGAGCTCCAGACACGATTCGGATTGATATCCGACT
ACAACAACTACGTGTACTTCAAAGGTATGAAGTTTGCATCGCCAGACGGAGTCTACTGCTCGGGTTACGTGATCGTGAATGGGAAGTTTCTAGTGAGTAC
GAAAAAGCTGCTATACATCGTGATGATCAAGATACTGCATGCACGCTTTACAAATGTGTACGCGTACGAAGTAGACGGCAACACTGTGAAGGAGACAGCC
AGGCTAGTGTACCCGAATACGTTCATGTGGTCGGACTTGTGGCGTCTTAACGTCACGGTATTGCTTTAGACAAGAGGCTCCTACTCAACATTATAATACA
CAAGATCAATAGACAGAGTCTTAGCAATGAACAATATGCATTTGTTATATTGCTAGTGAAATGTCCTAGCTACTCGAATGGGTAGAGCTCTTCGACCAGG
TACATGGGAAATGATGCTTCTTTTGTTCGCTAGGCGTGCAACCTGAGAGGGTTGATTTTGAGTCGGACAATCACGTCCGAAGGCACCATCGCCTGAATTG
GAATTGTACCGATCAACGACGACAGAGAGAGAACGGTACTTGATTCAGAATTTGCGTCAAAGTCGATTATAACTACAACGTGCCAATGTCATCAGGCAAC
GTTGTGAAATTGGTCTCCCAGAGCTGCATGTTAATTGACGATGCCGGTAGAGGTTGCAAGGACCTCTCGGGGAACTCTGCAACTTTGTTTTTCCACCAGG
ACAGAAAGTAGTCGtgtgtcgttgctgctgctggcattcCAGTTTTACATGCCACATCACAAGGCTTTTGAGATTTGGAAGTTTTCAACGTTCCTAATTC
ATGCAACGAGATATCCAGTGCATAACCTCATCTTTGAAAATGTTAGATATTCAAGTCCGTACTCAAAAAAAGGAAATTTCCGATCGAAGGTCCATGGGCG
ATGAAAAAACATCGAACAGCAAACCTCAGCCTTGTGTGTTAATTTTGTAGATTGGAACGCGATGCAAGTAAGTGCAAAGATTTTGTAACTTGATGTTCTC
GGTAGTGAACAAACGTTGAGAAATCTTCTCGTTTTTCGGCACTTTTTGGGAACCGTCGCGACTTCCTTCAGTGGTGAAGTCGCCGAGTCGAGCGTAGTAG
TCTCCATGTCGGAACCGCAGTCTCCACctgcgaccaagaagaaagttCCGAAGCATCTTCGTCATGCCATCTCCACCCGGAATAAGGTGGTGGTAGCACG
GCCCAAGCGTAAACCTCGAGTGTATCTGTTCAAGCGATTCGCGGGGGAGCCGATGCGCGAATGGGTGCAGCGAAACCTGGAGAACTCTTTGGGTGGAAGC
TCCTTTAGGGCTACGATGGCCATTTTAAGTACTTTTCAAGCTCTGTTCCATGTGAGTCTCAACTGGACAGGACTGCGAATTGGACCCAATTCATGGATGC
AAGGTAAGTACTTAAATAATGGGTACGTTGGAGTCAAAGAGGTTGACTTTGAAACTAAATAGTTTGTTTGTATTGACATCAGAGGTCGATTTCAGCCTGA
ACTTGGTGTTCACACTCGAGTAAGTCGGTAGTTTGATCAGTAGAGCGATCTCCATGAAAATTAATACTCACTCACTGGTTGCAAATTGCTGATAGGTATC
TCGTCCACGTGTACGCGGCGTTCGATCGACTCGAGTACATTGTGAGCTTCTTCCCTATAGTCGAGTTCGCTGTCGTGCTGCCGTCGTGGTTTGACCTCAT
CACAACGTACACCCCCAGCATCGACTACACGGACACACTCCCTCAGGTCTCGCGTATGTTGCGTCCGCTCCGCTTCGTTCGTATCTTCCGTCTTGTGCAA
TTCGCGACGTCATCCCTTCAGCAACAGGCTTGGGCTGCAATGCTCACTATCGTGTCAATCGTCTTCACTACTGCTGGTGTAGTACAAGCTACTGAGGCGT
GTCTTGAAGCGTGTAATGGAGAGCCACGTGTGTGCAAGTGCCGCGACTTGTCGTTCCCTAACTTGCTCTACTTTGTGGTGGTCAGCATCTCGACACTGGG
CTATGGCGACATCTCTCCGGTGTCCACGAGTGGCAAGTTTGTCATTGCattcgtcatcctcttcaccttcatTGTCGTGCCAATCCAAGTGAACCGAATT
CAGGCAACCATCACGTCCCACAACGACTACTCATCTGCCTACTcggaggccaagctgcatcCACACGTGATTCTTACCGGATACGTGAATGCCGACATgc
tctccgtcttcttcggtgAGTTTTTCCACCCTAGCAATCTCAACTGGAACGAACGAGTGGTCATTTTGAAT