Description :
From Genome Similarity Track
Location :
Scaffold_37:47204- 49955
Transcript NameFunction/comments
g9222.t1hypothetical protein

Sequence
2751 bases(100 bases per row)
ATAAAGCTGCGGGAACCTCAGCACAACTTCCTCCGGGATGTCCTGGTCGAAGATGCCGATTACAATGATCGGGAGCGCCAAGAAGAAGTTCCAGCCCGCC
ATCACGAAGCTCTCGAAGAGCGGAGCACCCGACTGCCCATTGAAGAAGTTGAAGACGAAGAGACTGATGACGAGAGCGATGTTCTTGTAGAACGAGTAGC
GGATGACCTTGCAGACCCGCTTGTAGTTGCACCGCCCGTGAAGGAGGACGAGTCTCGTGAGGAAGCGGAATTGCGCGACGGCGTAGTCGCTGGCGTTCAC
AGCCTGAACACCTTCTTTGCCGCAAATGCCCACGCCGACGTGCGCTGTCTGGATCATGCTCACGTCGTTGGCGCCGTCTCCGATCGCCAGAGTGATCGGC
TGCTCTCCTTTTCCCTTCTGGCCACTGCCTTGACGACCTCCTTTGCGTACGAGCTGAACGATGTCTGCTTTCTGGGACGGACTCACCCGACAGGCAATAA
GCGCCTTGCAAACTCTGGCAACATTCAGTAGTTTCTCGGTCAGCACCTCGACGCGTTGCATGGCTTCGGCAGACATTTTGAGTCGCGCGTCACGCGATGG
GAATATATGCACGAGCGCCTTGCCGTCGCAGACCATGGCCAGATTGTCGGCTACCTGGTCGCCTCGAATGAGTCGCTGTATCTCCGGAGATCCATGAAGG
TCGTCAAGCTGTGCACTCAACGCGTCGACGCGCTCGGCATTCACGTACAGCAGCTGCATTTTGTCGTTGATCAGCCGACAAGCGTGGCCGATGTTGATAG
CCGTCTCCTCCCGGTCTCCAGTGAGCACCCAGACCTTGATTCCAGCCTGCGCCAGGTCGAAAATGGCCGACGGCACTCCTTCCTGCAGCTTGTCCTCGAT
TGCCGTCACTCCCAATAGCTGCATGTTCGTCTCGATCATCTCGGCGCTTGCATCCAGCTTCTCTTCGCGGTCTTCGAGTGCTGTCGAGGCTGCAATGTAA
GCTTCGTTGTACTCCTTGTATTCCTCCGCAGTAAGCACTCGTCGCCCAAGTACCAGCGTTCGCAGCCCTTCACGAGCGTAGTTCTTAAGGTGTCCAACCA
GTTTCGCGTGTGCGGCAGTATCGCCGTCACTCTTTCCTGGTGCAGCGCGTTCGAGCATCATGTTGTCGGCGCCCTTGCAGTACAAAACGTACTCGCGGGT
CTCTTCGTTCACCGCTACCACTGACATCCGCTTTCGCGTCGAGTTGAACTCGTTCACGTTAACGATCGTGTGGTATTTGGCAGTAGGATCGGGTGTCTGC
TGTGTGTCTGCAGTGTTAGGGGGGAGCAGAGACTGCTTTCGAGAGACCTCCACCTTCATGAGCGGTGCCGGCGCCACGAAGTTGTATCCCAGGCACTTGG
CAGCCTTCACTAGAGCTTCCTCATCTGGTGATGACGCGCGGTAAGCAATTGCACCAGTCTTGGAATCTGTCTCGGGGATCACCGTGTGGCAAATCGACAA
GAGGGTGAGGAACTCGTGGATGAGTTCGCCTTGCTTGCCACCGGCGTACAGCGTTCGCAGCAGCCCTGGATCGTCGAAATGAATGCTGGGATCGAAGTGA
ACCTGGGCATCTTTCGGGTCACTGCCCTCATCGTTTAGCGCCACAGACTGCACGGGTGCTGCAGGCGATACCGTCTCGCGGATATCGTCGGTAGAGTCGA
TGTCGAGCCGCACTGCACTGCCAGCTCCGTCGGCGAGCGGGTTCACTTTTGCTTTCGCTGGAGATGGCGACTTGGCATTTGGTTTGGCACTGCCGCTAGC
GAGAGCAGCCACCGCTCGTCCGATCTCGGTCGTGCCGAAGCCGTACGAGATCCCACCGATCGAGCACTTGCGGAACTCCATGACGTTGCACGTCAACGTG
CCGGTCTTGTCGCTGAAGACGTACTCGACCTGGCCGAGCTCCTCGTTAAGCTCGGACGTCCGCGCCACTGCGTGCGTACCTTCGAAAACCATCTTGGCGT
CTGCCGTGATCCGGTTGGCTTGCAGCACCTTGATGATGTCGAGCGAGACGTAGAGCGAAATGGGCACGAGGTTGTTGTACAGGATGAGGAACGTGAAAAA
GTTCACGACGAAGTCGCCGACGCCGTCCGCCTCTTTCATGAATGGCAAGTACCACACGCGACTGGCGTTCGCCTTGCTCCAAAACGCCGCTACTATCGCG
CTTGCCAAGCAGAGCAGAAACATGGTGCTGAAGATCAACAGCATGCACCGATTCGCTGTTCTGTAGAGTTTGCTCTGCTTAGATGGCGCCGCTCGGGAGT
TTTGAAGCAGCTTGGTCTCACTACCTGTAAAGATCACGAGACCCACGACAAAAGCGCAGCTTCGAAGACTGCAGCCACGGAGTAACAGGTTCTCGGGGCC
TAGCGGTACTGCTGTTTCGCCTCGGTCGCTCTCACGCAGTAGCAGTCGACCGGTAAATGTGTAGAGCTGGTTGTTGGGTTGTTCATGCTCTACAGACCCG
CGCAGCCGTCGCACGGCTGAAGCACACACGGCTTCCTGCGACAGAGGACTTCCATGCAGCTCACGCCAGCCTACAGCCTGTGCCGTAGGCTTGACAGCAA
TTCGTCGCTTGAGATTTGTCTCGCCGTCCAGATTAGACGTCTCAATGAAGCACCGGCCTTCCTCCTCGGACGTGGCCAGAATCACCAGGTCTGCTGGTAA
CTCCTCGTGGTTCTCCACACACACGAGCTGTCCAACCTGTAAATCTTGCCA