Description :
From Genome Similarity Track
Location :
contig_38:472030- 474798
Transcript NameFunction/comments
g7161.t1hypothetical protein

Sequence
2768 bases(100 bases per row)
ACATCTTGGTCCAAAATGGAGGAGGCAACGATCGGAATGGCCGTCAGGGCGATATTGTACAGCTGTGTTCCGCTCTCCAAGAAAAACTTCTGTCCCGAGA
ACCCGCATAACAGTGTGTACCAATATTGAGCAGCAGTGAAGAGGATGTTCTTGTAGAATATGAACAACACTAGCTGAGCCATTCGCCTGTAATTCCAACG
ACCATGCACAAGCAACAGGCGCTGCAGAAAGCGAAATTGCGCGATAGCATAGTCACTGGAGTTGACAGCTTGCATGCCCTCTTGGCCTGAAATTCCCACA
CCGACGTGCGCTTCTTGGATCATTGAAACATCGTTCGCTCCGTCTCCGATAGCAAGAGTACGAACTCCAGGTACGTACTCCTTGATCAAAGCAACCATCT
CCGCTTTTTGGGCTGGTGATACACGGCAAGCGATAACAGCTTTGCAGTATTGCGAGAACTCGGCGAGCAGAGGACGGCACGACCCGCGAAGGGCAAACAT
TAACGTCTCACCATCAATGACAAGGGCCAACTCGCGGAGATCACCTCTCGTACTGGGAGGCGAAGCGAGGTAGACAGTCACATCTGCACTGCGGGCTCCA
ATCTCATCTCTTAGCGTGCTCTCAAGTACTTCGGGAGTTGCTGCGATTTTCGAGTTGATGATAAAAAGCTTCATGTCGTTCGTTATAAGCTGGCAAGCGA
AGCCGATGTTGATAGCCGTCTCCTCCTTGTCACCAGTGAGTACCCAGATTTTAATGCCCGCACACGCCAAGTTGGCGATTGCGTCAGGAACACCAGATTG
CAATTTGTCCTCGATTGCAGTGGCCCCAAGCAGCTCCAAGTCGCACTCAATCTCGTTCATACATTGGTCAATTGCGTTTGGGAGGTCCTTCTTTCGCTTG
TCGATTTCCGCTAGGTTGTTCTGCGCGTCGTGGAACCTTGTTGCCCATTCGGCGTAATACGAACGCTCAATTTCACGAACCGCAATCGTCAGAGTCCGCA
GTCCGTCTTCAGCGTATTGGTCGATATGGCGCCGAGTGATCTCCTGGAGCTGGGAAGAAGTAGATTCGTCCTCCTTGTCCTTCGCTAGTAATCCGTAGAT
GATAACATCTGCACCTTTGGAGTACAAGAAGATCCGTCCATTTGGGTGACGGATAATCGTACTCATACGCTTTCGCGTACTGTTGAACTCGAGAACGTCC
AGCATCTCGTACTTTTGTACTATTCCACGAACTTTGACATGAGCGACACCCGGAGATCGATTTACGAACTCATATCCAAAGTAACCTGCACCCGCAACGA
GTGCTTGTTCATCAGGAGATGAAGCCGACAGCGTGATTTCTTTGGAGTTTTCGTGCCGCTCTGGGATGACGGTGTGACAAACTGCAAGATGCGTGAAGAA
GGCATCAATACGTCCCTGTTGGACGGAGCCTGAGTCCCCCTTCATATCATTAAACAGCTCGGGACCATCGAAATTTACGTAAGGAACCTTGGGCCCCGTA
GACTGTGCGGTCATATCTGGAAGGGGTTTGCCGGCACGCCTTAGTGCCGCTAGCCCGATCTCAGTGGTTCCGTTTCCGTAGGAGACCCCGCCAATGGAGC
ACTTCCGGAACTCCATGACGTTGCAGGTGAGTGTTCCCGTTTTGTCCGAGAAAATGTACGAAATCTGCCCGAGCTCTTCGTTGAGCGACATGGAGCGCAC
TAATGTCGGGGTGTCTGTTTCGGGGTGGTAAATCTTGATGTCCCACTGAATAAATTGCGCCTGGAGATACTTGACCATGCTCATGGAAACAGCAAGTGAA
ATTGGCACGAACTGGTACATGAGTAGCAGATAGTAGAATAGCATGACAATCCAATCCACAAAAGCGCTGTTGTCGGACACGTTCATTTCCAAGTACCACA
CAGAACCGTTGTTCGCCTTCCAGGCCACCGCTCCTGTTGCACCTACAGCACTGAAGACAATCAAAATTGATAGCAACACAACCGTGTACCGGTTGATCGA
CCGGTCCATGGAACTCATCTTAGACGGAGGCGCCGAGTTGCTCATCATAATCTTCGTGTCCTTGCCGGTGTTGAAAACCATACCGTGCACCCAGTCGGTG
TTTCGGATGATACAGCCACGCAGGATGATACTTTCGTACGGGATGGAAGCGTTCTCCTTTCCTTCAAGCTCCAGCACACCCTGGAAACTGTTGATTGCAT
TGTTCGGATGTTCGCAGCGGATGGTGCCTTTCATCTTGACCAAGTTATCAATTGAGCCCATATCTGCAAGAGTACACTCCATTGCTGATCGGACTTTCAT
GTTGGTCTCTCCATCCAAAGACTTGGTCTCGACGTAGCAAATTCCACACGGAGGCTGATTAGGAATTTCACTCACGGCGAGCACGAGCATATCTGCCGGT
ACCAGTCCTCGATTCACCACCTTGACAACGTCGCCTACTACGACATCGGCCCACGTAGTTGGAGTGAACTTCTTCGATGCACGGTCTAGAACGAGTGTCG
GACTCGCGTTGGCAACGTTGTCAGCTTGGTGACGCTTGTGGTCTTCGAGGATAGCAAACACGCCATCGACGGTGATGATAAAGAGGAGTGGGGTAAGGTG
GAAGGCTGGCCGCCGGTGTTACTGATGTCAGGGATGCACTGCAGGATACAGATGAGGAGGAAGTAGAGGTTGGAGAGTTTGCGGAAGCTCTCGAAGAGGA
ACTTGGGCAGGAAGCTCGCCACCGTGTACTTGGACGTGACGATGAAGTTGTTGCAATAGCCGGCTTCC