Description :
From Genome Similarity Track
Location :
Scaffold_426:4720- 5994
Transcript NameFunction/comments
Phyke_g9384conserved hypothetical protein

Sequence
1274 bases(100 bases per row)
CTTCGAAGGGCATGGTAGTGTCGGTGTTAGAGACCGCTATGTGGAGAATGGGGTCATCTTGATATGAGTAAACGGAGACGTTCGCTCTATGAGCATCCGC
GAGACTGAGTATTGCAGACAGCAGTGTGAGCGCAAGCAGCGCCATAGTTCCCATGTAGCTCAGGATGAAACACCCCCTTGTTGCGATTGGCTAAAAACCT
CCGGGTAACGTATCCGACACAAATGGGGTCGGGCACAGCAACACATGTcgagcacagcagcacatatCGGGCACTGTAGCACTGCAACAAGGTGGCATGT
ACATGAGCTAGCGACGGCTATTATACGATGGAGAGCAACTGCTAAGCTGCATTCACACGAAAATCAGTCGCGTGGTGCGAGTGTGCATTCACTTACTTTC
TGCGCCGCCTCAGCACTCAGCGGCTATCTCAGAAATTGCCATCTACCTTCTCGGACTACGCCGCAGGGGTCACTTTTAACTCATGATCTAGCAGcgtgtc
ttcatctgcagcgaAGTGGAAGTGGCCCTGCACGCTCTTGCCGTTGAACACATGAGGCAACCAAAAGGCGTCGTCTGTCCACATGTCCTTGAACGGGGCC
TCCTTGACGTCGAACCATTGCGGTTTCATCTCCTCGCTCTCCGACGGTTCTCCTCTGAATTTGTGCGTCAGGAACACATGCACCTCCTACAGcagaaagc
agcagctgaaatgAGACTCTTatgctctctctctctcagtAAATGACCAGACTAGGGCTCTCTATCGTTTCGTTACCAATACTTCCTTGGCCTCTTCGAA
GGAGAATAGCAGCACACCACGAGGCTCCAGGTCTCTCTCCTCCACTGTAACGTTGGCTTCCTCCTGTATTTCACGCGCTGTCGCAGCCACAATACTGTCG
TCGGAGGCCTCCACTTTGCCCCCAAATCCGTTCCATTTGCCCTTGCCAAAGCCCcgcttcttcatccccaGGAGCACTTGAGACGAAGGGGCAGACGCAC
TCTCACGCATGATGAACGCAAGCGTCAGGAGCTTGCGGGGTAACGAAGGCACAGACAGCATGGTCGTCACTAAGCCTTATTGGCGTAATATGTATCAGCT
GGTGATCATCGTCGCACAAATCAGTTTTCCCTATCAAACAACATATTGTATCCACCCTATTTTGCTTCCTTTCGCGATTCAAACCACCCTCCCTTTACTG
TCTTTTACTTTATTTTTGTATTTCCTCTCAAATGTTGGGTTCCATCTCCCTCTCACTAACGTCAGGTCTTGTGA