Description :
From Genome Similarity Track
Location :
scaffold_20:47174- 49418
Sequence
2244 bases(100 bases per row)
AACTACTTGACACGAGACACGAATTTGTACTGGCTGAGCTGTCGGAGGGAGCCTTTCTGTACCATAGCTCGGATTGCGCGTTGAATAGCATTAGGGTTGT
AGCCCTGAGCTTCGAGACGGCTATACAACGCGCTTGTTTCGACTCGCGTACCAATGCGTAGCGTGCGGTTGATACTCTGCTCTACTTCTTGAGCTTTTTC
ATGGAAGCCACCAAACAGTCCCTGCGTACCGCCGTCCTTAGCAGCGTTCATAGTACTCACACTGAACAACCGGATCGCCTCCTGCACATGTTCACGTGTG
GCTTCGTTGAGTAGATGCATCTTCGCCAGTGATTCCGCGATACGCACAAGAGCCTCAAGTTGACGCACTGTGACGGGGATCGTAGTTTCGCCACCTTGTG
TTTGACGCACATCGTCACGCACACCAACGTAAAAGTCCTGCAGCGCCTGTGCTGCTCCAACTGACAGTCTCGGTGCACATCGAGTACGACAGTAGGTAAT
GAATTTCTTGAGCAGCCACGGCTCAAACTCGCCACCACTTGAAGCATTTTCACTTGCCGAAGGTTTTCCAGCAGCCGTTGCAAGTGCATTGGTGTGCATA
CGCACAACATGTGCAGCCATTTGCCTATCTCTAGCATCGTCCTGAATATCTCGGACAATGAAAATCATGTCGAAACGACTCAAAATGGTACTCATAAGAT
CAATATTTTCCGAAGCTGAGCGCATGTCGTCATAGCGACCAAACACTGGGTTTGCAGCAGCCAAAACACTTGCACGTGAGTTCAAAATAGTCGTGATACC
AGCTTTTGCAATGGAAATGGTCTGTTGCTCCATTGCTTCGTGAATTGCCACACGATCTGATTCACGCATTTTATCGAACTCGTCAATGCACACGACACCA
CCATCAGCCAGCACCATTGCACCTCCTTCCAGGTAAAATTCACCCTTGGAATCACGGATAACTGATGCAGTTAAACCTGCAGCACTACTACCTTTTCCTG
AAGTGTACACACCCACTGGTGCAATTTTCTCTGTAAATTTGAGAAATTGCGATTTTGCCGTACTAGGATCTCCCAGCAACAGCACATTGATATCACCACG
TAATATCATGCCATCGGGCAGCCGTTTTCTCGATCCACCAGCTAGTAAACATGCAATTGCCTTTTTGATGTTCACTGTGTAATCGCCATAAATGGACGGA
GCGATACTTGTTGCCAACTTTTCGTACAATTTTGGATCTCTTGCCATTTCATGGAATTTTTCCTCTTCTGCGGGTGAAAAAGTGGCTTTTGCACGTCCAG
CGCCTTCTTCGTCAATTTCAATACCCACCACACGCAAATATAGTGTACGAATGGCAACAGCTCCGACATTTTTGCCTCCAGCATTGACCACTGACGTAAT
CCCCACAACGGACACTCGAGTACCGGGGGATGCTCTGTCCACCAAGTGACGATCCGCAATCAATGCGAGATTACGTGGCATCTCACCAGTCGGCACCACT
TCTGGGTTTTCTTGCAACTTGAGTGTTTGTTGGTCTACATATTCACCTTTGTCAGGCAACACCATGTACGAGTCTTTGGGACACATTTCTCCAGGGGTTA
CGCCATCCTCGTCCCTATTGCGGTCACAAATGCGGGGGATACTGACACCTCCCATTCCGGAGACGGCAACTCGCTTGGTATGTCCACAGTTGCGGCATCT
CAAAGTTGCCGACACGCACTTGGTTCGGACACGAGTGGCACTGATTACGATACCTGGCACTTTCACCAGTCGGTTGATCTCCTGCGAGTGTACATGACGG
AGAGCCACTGGGGCTTGATCACTGGTGAGAATTGCTTGGATGTCTGGCAAGTTTGCCGCACGAAGTGACGCATTATCAGATGACGAATCTGCCGCAACTG
CCTCTTGCCCTTGGGTGCTGGACACGAGCAGTTGCGCCAACATTTCCTTTGCTGCATTCTCTAAAAGCGGAAGTTGTTCTTTGGGATTTTTGAGTAGAAG
ATCTTGCAGTTCTTGGTCGAAAGCTGCGACGTGTGATAAGTTCACCGTCACGAACCAATGATTGCGTCGAGCGTTGGCGAGGAGTTGCTCACGGTAGTAG
AACAACGGACCCACGCGGAATCCGCGTAGAAATGCCAGTAACCGACGCTGTAGAGCTGCTGGACTTGCGCCTTGACGAGCATCCGAAGCCTGCGCGCTCT
CCATACCCACGGCCGACACGCGGCCAGCATCCCAATCCATTGTG