Description :
From Genome Similarity Track
Location :
Scaffold_1694:4717- 5850
Transcript NameFunction/comments
Phyag_g11284conserved hypothetical protein

Sequence
1133 bases(100 bases per row)
TCTTCTATTGATGTAAAATGCGGCAACCTGTGCCGCTGCGGACCGACctaatgcagcagcacctcgaagTCGGGAGtcacgacgagatggcgcTCCACGT
TGCCCAGGATACTCAGATGCTTCTCGGTTGTGTTGACGGCGTAGACCTCCTCGCAGAACGACGGCGTCTgggccgccgccacctcgaACTGTTTGTCGCC
GAGCATCAGCACCATCTTGCCCGACTTGTGCACGCAAATCTGACGACGACACAAGGAGTAGCAGTGTTAAATCTCGGCTCAACAGCAAAAACCTAGCTAT
ATCTTTCTTACCTTGCCAACAAACCCGCCCGGCGCCGTCTCGATAGAGTGGTCATACACGCCATCATCCCTATCATTTCAAACAAAGAAACAGTCAGAAT
CACCTAATagaccgccgccaccaacagccAAGTGTCCACCACGTACGGTGACTCGTCCGAGTTTTTGTTCTCCTTCGACTCGTCTGCACTTTCCATCGAC
TCATCATCATCCGTACtcgccgccaccttggccACAGCACTCGACAGCGGCAATGTCGTCGGCatctggatgaagaagagggagTCGTCGGACGCCACCA
GGTCGCCCGTAGCGTCGCAGAAcactgctccagcactttCCGGCTCCGGCGGCCTCACGACCGGCAGACTCATCGGCTCCATCACGGACTTGACAACGGG
AGGCCAcacttcttccacctccatctcTGGCACTTTCCCTCCtggcatctcgtcgtcgtccagcacactGATTCCTGTACCACCAGCAGCCGAATAGTCG
GCCGACGGAGTGGCTCGTGGAGCAGGCGCATTGCCTGCTCCACTGTACGAAGATCCACCCGAGAGGGTACCAACAAATGCAACCTTCCCGCTCGGTAACA
CACCAcggccacgaccacgacctcGTCCGCCGCCACGTCCTCCCCTGCCTCCACGACCGCTGCGCCCTCTGTTGTCGTGTTTGAGGGCCCCAACGCCAGT
TGAGTGCGGCTTAGCATCGTTCGAGCGCTGTGGTCCGGTGGAAGATCCTTCTCCGCGCGATTCCGATACTGGACGACGCTTTGCAGCCTTTGGAACGAAC
TTGGGGCGTCGTGCAGGGGCAGCAGATGCATCG