Description :
From Genome Similarity Track
Location :
Scaffold_3:47169- 49805
Transcript NameFunction/comments
Physo_127806hypothetical protein

Sequence
2636 bases(100 bases per row)
GAGCTACGACCTGCTGGCCGTGTACACGTGCTTCACGCACGAGGCGCTGAGCTTCAGCGACTACGTTCTCAAGTGCCGCGAGGAGAAGGCGGCCATGGTG
TCCACGGTGGACAAGAAGGAGCTGGTGGCCTACCTCAAGGGGGACATCGAGGCCAGCGCGCAGATCCTGGACGCCAGCGGCAAGCCCACAGAGACCAGGA
AGGAGCGCAAGCCTACCGGCTCTACCTCCGGTTCTACCAAGAAGAAAAGGGAGAGCGAGGACGAGGCAGCCCGCGCCTCCGCCAAGAAGAGGAAGCTCGA
GAGCGCGCGCCACCACCGAGACGGCCACAACAAGCACGGCGTGAGCCACCACAAGACCCCCGAGGAGCTGCAGGCAGAGGCCCAGATCAAGAGGATAACG
GATAAAGAGTACGTCAACAGGACGAGGACCACGGTGCTGGACGCGCACAAGACCAAGTTCGACAACGTGGCCAAGACGCTCGAGCTGGTGAATGCTGAGA
CCAAGGAGAAGATCGAGAAGGCCACCAAGGCCTCGGCGCTGCTGGCCACCACCACGGCCAGGAAGGAGCAGATGCCGCTGCATCGAATGGTCAAGGAGAA
GATCCTGGGCACGCCGATTATTGTGGTGCCCGCTGGCTTCTCCGACTTGTTCACGATGCTTAATGCCAGGGACTTCTTGGAGGACGGCGTGTATGTTTCC
AACGTGCAGAAGAAGGCGGACGGACACCGCAAGCAGCAGTCAATGATGATTACGCATGAGGAGGACGGACACGTGTACACCTTCAAGATCGTGGACACTG
TCAGTCGATTCCGGGATAAGGACTGGTGCGTTAGTAAAAAAAAAGGGGGGGGGCGTGTGTTGCTGTGGTGGACTGCTAACTGATGAAGTTTTGATGCTCC
TGCTGGTTCATGGATGCAGGCGCTCGGTGGTCGGTGTCATTGTATCGGGACAGTCGTGGCAGTTTAAGGGCTGGAAGTGGAAGTTCCCGCTCGAGGTGTT
CAAGAAAGGTATGGCACTCGCTTGTGATACTTCGTGCTAAGGACTGTGGTGCATGCGTGGTCTGACACACCGAGTATTGTGTTATGGTGCAGTGTGTGGA
GTTTACATCTACAATCAAGGGTCCCAGCTGAACCCGGACATTAAGCAGTGGGATGTGAAGGTGCTAATGGTAAGGTTGACTCCTCGTGCAATGATCGTAT
CGTCTGAACTGTGCAGCTAACGTCATGCATGCTACTTCGTGCAGATCCATCCCGACAAGCGGCATTTGGACAAGGTGGCAGCCAAGGAGTTCTGGCGCTA
CTTGTTCGCTTTCATCAAGCTGAAGCTGCAATAGGCAGCACGTGCATGCTCTGCCATAATCGCAGCAAATACAAACACGGAAACTAACTAACGAGGACGA
TTTCAAGTATCGCCACCGCGCAAATTGGTATCAAAAATGATGCTTTCATCTTGTGAATGATGGATAAACCCTCTTCGTTCGAAGGCCATTCAGGAATTTC
CCGACCAAAAGATGGTGACCCTGATTTGTGCGCTCGTTGGCGCAGAAGTCGGCGCAGAAGTCGGCGCATTTCATGTCGACATTGATGGAAGCAAACTGGT
GGGCGAGTTGAAGGTGGAGATCAAGGAGAAAGAGAGTATTGCGTGCCCTACGCGGTTCATGGATCTCTTCCTGGCGAAGAAGGGAGACGCGTGGCTGCCA
AGCGATGATCCAGCGGCGCGGAAACTGGCTAAGGGGGAGATCGATGAAGAAATCGAGCAATTACTGAGTGGAGATCCGGTGGACCCGGCCAAGACGATTC
AAGAAGTGTTGGTAATCAACCGCATGACGCGGAGGAAGCGGAGAGCTCCGAAGGCGGTACAAATTCACATACTCGTTCGTTTTACGCTCTGGAAGCTTGA
AAAGGCCGCGAGATGAGGACGACGGGGTATGGATACCAGGACGGACGTCGTTGAATCTCCGAAAACTGTTGGAAACGAGCGACAAACGCGGCGATTTGCC
GCCGAGAGGCGAGTTTTTCGACTTGTTCGAATGGATTGACGACAACTGCAATGAGGTCAAGGATATTGGAACAATCGCAGAACTTGTGGAGTTTACGGGT
CCGAACTTCTACGTGCGGAAGGAGATTCTGTGTGTGCTGGAGGTTTTTCACAAAGTTTTTCCGGAGTTTTTTTGCACTGGTACAAGAATTTCCAAGACCC
TCATTTTGACAGGGAGTTCAGGAACAGGCAAGAGCTTAGCGTTGCTTTGCTTCTACAGATCGCAATTCGGAAGGAAAAGCCGGTTGTGTGGCATTGTGCT
GGTGACGGTGGGTATGGCAACGATTCCATAACGCGTTTGTTCCTCGTCGGCAAATACTACGAGTGGGAGGGCATTACGGGTGGAATTTACACGTCGCTGT
TTCAAGGCAGGCACGACAAGAGCGCGAATCTTCTCGACTGCTGGTTTTGTCTCGACGGGGTGGATCAGGAGCGGATCAACGATCGAGGCTGGCAAGATTG
CTATCGACTGCTGACAACTACTGGGCAATTCGACGCGAAGAGCGAAGACCAAACACTCTGCTTGCTGCCATACTGGAGATAAGAGGACTTGGAAGATCTC
GCCAGGAAGGTTGGCTACCCGGACGAAAGCGACGTT