Description :
From Genome Similarity Track
Location :
Scaffold_110:47154- 50845
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh-pir_contig_110-abinit-gene-0.82Transducin family protein

Sequence
3691 bases(100 bases per row)
TTCTACTTGCAGAAGCGGATAGTTTGGAGCCCCTGACCGACCACCACGACCACCTGCGCTCCACTGGCATCGCTAATGCTGCTGCTGCTGTCCATTTCCT
CCCAGACAGCAATGTCCGCAATGTCGGCACACTCGGAGAACGCCGCGCACTGCCACTGGAGTGATTTCTTCCAACTCTTCCTGTCTTCAGGTCCATCATT
CGAAACAACCGCCCACTTGCTCACGCGTTGGTCGTAGCCTGCGATGAACACCACGTTGCCGTCCGAGAAGATCGTCTTGATTGCCGAGCCACTTGCGTTA
ATCGCGCACGTGTCGCTCACAACACTGTTGTCGTCATCACCATTCTCTCCTTTCAGCAGCGACTTGATCTTGAACTCGCGCAGACGCACGTTCTGGTCGT
CGCCGCCGCTGATGATCGAGAACAACTCGATGTCGTTGTGCTGGTGCTGGTGCGCGATCGTGAGGCAGTTGACGCCCATGTCGTGCGCCAAGTACGACGC
TCTTGGTGTCAAGTCGGCCAATTTGGCGCTGGTCTGGAATTGCTGCGGGTCCAATACATCAAGCTCCAGACCAGCAAGGTCTCGCACGATCCCGCCAAAG
TCCCAGATGTTAACCATGCCGTCCGTCGAACCCACAGCCAATACCGCGACATCGCCGCTACCACCGAATCGCTGGAGACCCGCACAGGTGAGAATGGGCT
TCTTGGACGAGCTTACCTCGCCCAGTTCCATAAGCTTTCCCTCTACAATGTCAAGGAGCAGCAACTGGATCGAGCCCTCCGAGTTGCACGCCGTCACGAG
GCGGTAGCGCCCATCATCGCCTTGAGCGTTTGGTCGGATCGCAAAGGTCTCAAGCCCGAGAATGCGATGGTCCTGGAGCGAGTCCTCCTTCTCAAAGCCG
CATACGTGCTCGATCACGTCCACTTGGTCCGCCACTTTCCATACGTTGATGCGCTGCTTGCCGCCGCCAGAGAGCAGAAAATGTGCGCTGTGGACTCGAA
ACGAGGTCATCGCACGCACCGTGGTCGTATGGGCGACGCCCGTGGACACGCACTCCCAACTCACCTTGTTCTTGCTTTCTAATGTAGCAACCTGTTTGTG
CAGCTTGACGCTGTTATCCTCCGCGGCCGTGACGAGGCGGTCACCGATCTTGGCGACGCACGTCGTCATCTTGCCGTGGAACAAGTGGTGCAGCGAGGTT
CTCCCCAGCACGGGCTGCTGGAACGCGGGCGCCTTCTGCGTGATGGTCGAGTGCACCTTGAGCTCTAGCAGGTCCGCCTTGTTCACCACCGGCGGCGTGA
ACAAGAACGTGTGCGCTGGCAGCGACACCGAGTTGTTCACGTCCTTGGTCACGAGCGCATGTGGTCGACGCCAGCCACCGCACTCGATGCTGAACAAGCG
GTACTGCGCCGAGAAGTTGTGCAGGATCGCCTGCGACGCATAGAAGCCGAGCACGAAGAGCTCGTTGTTGGCGTTGTACCAGAGGCTCTTGATCGTGGTC
ATCCCCTTGATCGAGTCGTGGCCGATGAATGTGAGACTTAGCGCTCCATCAGCTTGGCTAAGGTCTGCCAGGTAGGAGCAAATGTAGCCGTCGTGACCAC
CGGAGAGCACGACATTGTCGCGGATGAGCAGCGACGTCACTTGTTCGCGGCCGTGAACGCTTTTCAGTACAAGGCTCGGTGTCTGAGCAGGTTCGTCGAT
ACTTTCGGCATTGTTGATGAGCTCAAGCGCGCGGCGGAACACGAAAAGGTTGCCGCGACCATCACCGCAGAGAATGTTGCGGGTTTCTCCACGGTCAACC
ACGAGCAGCGCCGATGCGGAGCACTTACCAGGGCTCTTGAACGCCGTGAGCAGCTCCATTCGCACATTATCGCTCTCTGATCCGCCAGCAACAATAACAG
GCCGCCATTCGCGGATCGTACAGTCCGCACAGACGGTGAACAGCGAACTGCTGGTATCGTCCTTTGCTTCGCGCGTCCAAAAGATTTTCACGACGCGCGA
GTCGTGCGCTTTCCACGAGTGTGAGAGCGTCGCGGTTTCAATGTCGATGATCGACACAACGCCACTCGAGCTGCCGGCCAGCAGTACCTGGTTGAGCGAG
TCAGTCGTGAACGTCGAGAGGTTCGATGGTGGCGTCGATGAAGCCTTTTCTTCATCGCTATCATCGCCATCACGTTCTTCCTCTTCATTGGGGATACTGT
AGAACAGCGAGGACGTCTGGGCTTTGAGGTCGACCTCAAAGATTTGCCCGAGCTCCGACGCCACGTACCCGGTCTCTCCGTTACTCTGGTTCACCACGAT
GTCTCGAATGCTCAGCGTCTTACTCTTGCCCTTGGTCTTCTTCTGGCTCTTCTTCTTCTCGTGCAGGTGGCTGTTCTCCTGCGTGAACAGCGGAATGCTC
TGGCAGAACGCGTTCGAGTTGGCGGACGTGGACTTGATCTGGTCGTGCAGGTTCCAGAGCTTCGCGGCGCCGTCGGTGCCTCCAGTCGCGATGATCGCCT
GCGATGGGTGGATCGCGACGCGCCACACATGCTTGCCCATGTGGCCCTGCAGACTCGCGATACAATTGCCGGCAAAGTCCCAGATCTTGCAGATCGAGTC
CTCACTCGTAGTCGCGAGACCGTACGCGCAGAACTTGACGTCCCAGAGCCGCGCAGTGTGGCCCCAGGAGCGAAACAAGGAGCGGTACTCCTTGGCCAAG
TCCACGCTTGTAGGAGGCTCAGTGTTCGCTCTCTTTGCAACGATATCCATGAACGCGATCGTCTGTTCCGTGCTTTTAAAGAAGCCGCCATCGTCGCGCA
AAGTGTTCTTCTCAGGAAACTCGGTAGCTTCGCGATTCGACCAGAGCTGGACAGTTCGGTCGTCCGAGACCGACGCAAGCATCGACGCGTCACTTGACCA
CTCGAGCTTGAAGAGCACACCGTCGTGGGAGTGCAAGCGCTGTGCTGGGATGATCGCATCCTCGTCTTCACCGCTGGAGGTGCTGCTGGTGTTACTGGAA
ACAGGTTTCCACAGCAGGATCTGCTGGAAAACTGTGCCGGACGCCACGACCAGCTCCTCGGCACTTCTCCCGTGGAACGCAAGCGCGTACAAAATGCAGC
GCTCTGCACACTGCACTGTCCGCATCACGCGGTCGTGCTTCGGCTCCCAAATCTGAATGAAGTTGTGCGCCAAGCCGACCGCGAGTAGTGGAAACTTGGA
GTACGGGTTGGCCTCCTCCGAGAGGATCTGTACATCGAAGACCCAGTCGCCAAACACTTTGGTTGTGCGTTTGCCAGCAAAGCACTCTAGCGTCTGCTGC
GTGATCGCTTCGTCCGGCGTCTGCGGGAGGTTGTGGAGGCACGCGACGCGTTTTTGTCCGAAGAACACGGCGACATTGCGGATCTCAGCGTCCCCCACGA
CGCTCGGCACTATTCATTCAATCGCAAGAATCATGCCGTTAGTGTACAGCAGAGCGTGCAATATAAGTCCTACATACTGTAGCACATGATCATACACACG
CACACACACGCACACGCACGTACCAAAGTCGCAGCCGTGCAGGATGCCGCGCGCGAGGATGTCGTGCTGCGCGATGAGGTCGCCCGTGGAGGTCTCGTAA
AGGAAGAGCGTCGAGCCCACGCCGACGTAGAGCAGCGATCCGTCCGTGGAAAAGTGCACGAGAGTCACTGCACCGATGTACTCGTGCTTCT