Description :
From Genome Similarity Track
Location :
contig_8:471491- 472959
Transcript NameFunction/comments
g2023.t1hypothetical protein

Sequence
1468 bases(100 bases per row)
GACCTCCTTGAGACGCCCGTGGCACCCACAGTACGAGTGAACCACCTCCTGTACCTGGAAGGCCAAAGAAACCCGGCCGCCATCGATCCAAGTACAATGT
TTTCCCACCCAAGACAGTGATATTCGATGTCCACCGGGCCTTGCCACCACCAGCAACGTCGACTTCGTCAATTTTGTCGCCTCCAGACATGATATTAACC
GTCACATCTTTTGTATCTGTGCTTGTGAAGTTGATGATGACCGCACCGTCACCCTTCTTGGCCCAGGAGCTCGAGCTTCCTTTGAAGGCCCTCTGCAGCG
TGTTCAAGCCAAGCGTAGCGGCTTCGGTGCCGTCGTCAATCTCGCCCATGAACTGCGTGGGGCCGCACACCGTCTGAAGGTACTCGGAAATCAATGTTGA
GAGGTCTGTGGGGTCAATCATCGACGAGGAGAGAGTGGAGAGACCGGTATCGATCCATTTGTACGCGGCCGCTTTCTCATCCAACGAGGTGCCGTTGTTG
CTCTTGCCACTCTTGACGAGGTCACTTATAATAACGCCGAAGGTCTTACGCAGCAATTCTCTGGTTTTGTACGCAGTCTCTTCGCTGGTTTCGGAGGCCA
AATGCTGCATACAGTTGTTCGTAACGATCGGGATATCGTAAAGAACCAGGTCGGACTCGCTGACCTTCAAGCGGATCTCATCGTCGGATATGTGCGGATT
TACTTCTCTGTATTCGTTCACAGTCAACCAGACACGGTCTGTCAACGACTTCATGTCGCCTCCGCAGCTCGAATTCTGTTGCATCGCCGTTTCGAGCGAC
TCAATCTCACCCTCCGTGATCTCTTCAGCGGCTTCCGTGAAGTTGGCTCCCTTGATGAAGGCCCGGAATCGCCCCCAGCTTGAGATGATATTGTCGTCGT
AAGTGAGGGCTTGCAACAGCATCCACTGCGTGGTGGCCAACACGATCTGCGAGAGCCGAAGACCTGAGGGGATGTCCTTCCCCATGCATGCATAGATGGC
CATGGGTATATCCGTGACGACGTTGTTTGTCTGGTACAGCATCAGTAGCAGCTTCTGTTGCGAGGTCTGCGGGTCTTCCGTCTTCACGTTGCGAACGTAT
CGAATGACACCTCTCATCACCAGGAGCAACTGGTTCGTGCACTTGGCAGCCCACGTGATCTTTTTGCCCAGTCTCGCCAGTTCACCGAACACACCGAAAG
TGGCACTACTTAAAATGGCCATGGCCAACGCGGAGACCTTGCTGGCGACTTCGAGACCACAGTCGCTGTTCTGTCGGATGCATTCCATGCCGCACTCCAC
CGGGAACTCGATCGGACACTCCGTCCAGCACGTGTTGGTTGCCTCGTTGCGGTCGAAGTTGCTCGGGCATACGTCCATCACGTGGGCTTCGCGATAACAT
GTTGTGTCTGACGAGATACTCCATGGGCCCACCCAGTTGCGGTAGGTCGACGTGACGGTACTGATGGC