Description :
From Genome Similarity Track
Location :
Scaffold_23:471436- 473536
Sequence
2100 bases(100 bases per row)
AGCTCCCACCAGATCGAGGCGTACGACATGAGATCGATCTCGTGCCTGGCACAAAGTACTGTGTCACGAGACAATGGCCTCTTCCGCGCGAACAGTGCGA
GATCATTGATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTTCCCGCCCTCGACGCCAAATTTCTGCGTTCGGAAGCCGAAC
GGAAAGTGGCATCTAGTTCATGCTTATAACAAGCTGAACAACGCGACGGTGCCGGTCCAAACACCAATCCCGCGAAAGGATGTGCTGTTGAACAACATGG
CCGGTAGCGTACTTTTCAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTGAGCACTCCAAG
CGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTTTAATGCCCCGGTGACGTTCAACCACCTGGTGACGCAGTTGTTCCGCCCTTTGCGTACC
TTCGTACAGACGTACTTCGACGACATATTCGTCCAAAGCCGTGCCGAAGGAGGCAAAACGGCCATGGAGGTGCACCTAGGACACCTCCGTCGAGTGTTGG
ACGTAATGCGAGCGAACAAGTTCTACGCCAACATCGACAAGTGCGTCTTCGCGTCACCAGAGATTAAGGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGT
TCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCAACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCAC
AAGTACAGCGCAGGGTACACGGGCTTCGCTGAGCCCTTGTCGGGCCTCCTTAAGAAGGGCGTCGACTGACGCTGGGAGCAGGAGCACCAGGATGCCTTTG
ACAGAATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGACCCTGCCAGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGACTGTGCCATCGG
TTGTGCACTGCTGCAGGCCGACACGGCTGGACATGAACGCGTCATATCGCTTCAGTCTTGGCAGCTCAAATCCGCCGAACAGAACTACCCTGTCCACGAC
AAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCCCGGCCCTTTGTGATCTACACAGACCACACGTCCTTGAGGA
CGGCGACTAACTCGCCTCACCTCTCCCAAAAGATGGGGACGTGGCTGTCCTACTTCGCGGAGTACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAA
CGTGCTTGTGGACGCCCTCTCTCGGCGTCCAGACTACGAGTTGGCCCACATCACACGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGG
GACGATGAGGCTGTCGCGCCTATCGTCAAGTTCTTCACGGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGAT
ATGAGTTGAAGGATGGCCTCCTCTATTACCGGGTGGGGCCCAATGAACCTCCACGGGTGGTCGTACCCAACGACAAGGATCTGAAGTTCGACATTCTCGC
GGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTATCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTC
GCCCGATACATGAAGACATATGAAACATGTCAGCGGGTTTAACCCGCAAGGCACGCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGA
AGTTGATGAGTCTTGACTTCATCTTTGGGCTTCCCACCGACGGACACGGAAACACCAGAATTTTTGTGTTCGTGTGTCGGCTGAGCAAGATGGGACATCT
TGTTCCGGTCCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTTTTCGTCGATGGCGTGCTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGAC
CGAGACCCGCGGTTCACGGCTGCTTTTTGGAAAACGCTGTTTCCTTTACAACGACGACGCCTCCGTCGAGAGTCGGATTTGAACCTCGTTCAGATCGACG