Description :
From Genome Similarity Track
Location :
Scaffold_1:471343- 476089
Transcript NameFunction/comments
Hyaar_Emoy2800114metal transporter, putative
Hyaar_Emoy2800115PREDICTED: BRCA1-associated protein

Sequence
4746 bases(100 bases per row)
TCCCAATAACGTACCGAGCGAAGCGCCTGCAAGAAGGCGACGATCAACGAGCCAAAGCAAATGGAACCAAACGACGACGTCGTGCTGCGCTTCAATGAGG
CACCTGTAGCACCTGCCGACTCGGTGTTGTACCAGAACGTCGCGACTGTACCTGCAACAGTCGTGTGTGCAACGTTCTTGAAAACCTGGAGCCCCCAGTA
AAAAGAGAGCAGCAGGAAGAAGAACGCGACGTAGGACGCTCCCGACTGTCGATACGCAGATCGAGTGGATGTTGTGGTCGTAGTGGTCGTCGAGCTCGGG
TTCGCTTTCGAAATCTTGTTGGCAACACCCAGCAAAGCCAATGCCCAGATGATTACCCACACGATCTGCACAATCGTAAACACAATCGAAACAATGTACG
TGGACGAGTGCTTGGCAATAGCTCCTTCCGCCACACGCAAGTTGGCAACGGCAAACGGAATGCGATGCTGCACCGCACGGGCGTAGCAAAGATTCAGCAG
CGCAATCATGAAACCAATAATGGCAATGAAGATATTGCCCAGGATGACTCCATAAGCAGCAAAGGCAAACGAAATGCCCACGTTGAACCACAGCACAAAC
AGGATCATGACCCGTGCGTGGGCCACAAAGAGCTTGACCATCACAAGAGCCAAGACCATTGACACGACGGCCATAGCGGTGGCAATCGCCAGCACGACTT
GGGTGTCGTTGCCCGGGAGCAGCTCACTCGCGTGGTTTTCTGGGTCCGTGACGGTCTGGACGCCCCACACGAGCATCAGGGCGAGAATTGTACCGACATT
GAGCACGAAAAGCAGTGCAAACGGCCAGTCTTGGCACTTCGTGCTTGTCTCGACCGTCTTTTGCTCGCTATTGTACAACAAAACACAAGACAGCAAAATC
GACAAGTGAGCCACCAAATGAGCGCTTTTTCATCAATAAACATAGTTGTATACAGATATAGTGTATATGTATATACAAGACTAAATATAAACATCTCGAT
ATTTACGACGGTAAAAAACGAAAAAACTCGCGTACGGTTTAATAGGGTTTACGTCTGGAACGCTCTGGACGCTCGGATCCGTATACCTATAACAAGAGAG
AGAGAGAGGGAGAGAGAGAGAGAGAAGAGAGAGGGGCACTGAATGGTCAGTCGCTTCATCCATAGTTCAATGATAGCAGCAACAACAAGCGCAATAGCGC
AGAGAGACGTACGACTGGGTGAACATGGCGCAACTATCGCTCTAATTGGCTTTTGCGACTTGACTTGTGCTTTTCTCTTGTTGTGGCGTATGCGTGTGTA
TACAAAAAGTGTATATTGTTTATGCGACAGAAAAAAGGGGTGCGTGGGAAGTAAGAGAGCGGGACAGAAAAAGACCACGACGATGCGAGGACACGATAGG
AACATTAAAAATGAAAATCTCTTCAGCTGCGACTACAACAGTGCGATTCTATTTTAAATCTCCCACGACGTTATCGCATTCTCTGCAGCCTCTATTGGCT
CAAAACAACAAGTCACTAAACAGGGGCGCTCCTTCGTCTTATTGACTCGCTCAGTAAATATGATCCGGTACTTACTCAGGACATAGGATGTTTACGTCTC
AGCGTAAATGAATTTCAGTAGCAACTGATTTAATTCAATTGATCAATTAATTGATTCTCCCAGCGAAACCCCACTTGACCTCCATCCTTTCGGTCTCGAA
CCATGTTCCAGATCCGCGTCGAAGCCGACGAAGCGCAAGTCACGGCTGATGACGCAATCCACTCAATCAACGAAAGCGCTTCCTTTCTCACTGGCAACCC
ACAGGTCCGTGTCATCACGGGCAAGTTGCGGTTCTACCGAGCAGACGAGACGTACACCACCCCGACGTTGTCGATATCGAACCATACCAATAGCTCAAGT
AGTTTTAGTGGTACAAGTACCACTAGCAGCGCGTTACTAACACAGCAACTACCGCGTGAACGCAGTGCATTAGTGTGCGTCGTAACAGTCCCGTCGCACA
TGTCGCCGGTCGAGATCCTCGAGTTTCTGTCGAGTTTTCGAGAAAACATTGCGCTCGTGCGGATTCTCAAGGACTCGGAACGAAATAATTGTATGGTGCT
CGTGCAATTTCAGACCCAAGACCGAGCGGACCAATTCTTTTTGGTACGGAGGGTGGCTGCTACATTGCAATTATTGGTCGCATTCTTAATCATGGCCCGA
TTATGGTCTCTTGATCTCTTACGCTTCTGTTCTGCTCTGTTCTGTTTGTTCTGTTTTGTTCTGTCTTCTGTGTCGGATTCGCCCGTTCTGAGATATGTAG
GAGCATACAGGCAAGTACTTTAACTCGATCGAGCAGGAACGGTGCAAGATTGTGTTTGTGCGAAGCATCGAGTTTGATCTCGTAGCTGGTGAAGATCAAT
TGACCTGCGACGCACTGGAAGAGAAAGATGCAGGTGGAGACAAGATTGTCGCGAGTGGGTTGATGAGCTCCCAGTCAGAGTCGAGAACTAGTAGAATGCA
GATGCGTAAACTGTTCCCGTTGCCACCAGCTGGAATGACAGAGATCCCGACGTGTGCGGTCTGTCTAGATCGCCTCGATGCTTCGGCGTCGGGCATTCTG
ACGACGCTGTGCAACCACTCTTTCCACTGTGACTGTCTCTTCCGATGGGAAGGATCGAGCTGTCCAGTATGTCGGTATAGTCATGGCGACATTGGGTCGT
CGTGCGAGGTGTGCGGTACAGCTGAGCACCTCTGGATCTGTCTGATCTGTGGCCATGTTGGCTGTGGACGCTACTCGGGTGAGCATGCCAAAGAGCACTA
TCAGGACACACTACACACGTACTCGTTAGAGTTGGAGACTCAACGCGTGTGGGACTACGCCGGGGATGGCTATGTCCATCGACTGATTTTGAACAAGCAG
GATGGGAAATTTGTGGAGTTCCCAAGCCCGAACAATCTTAGCAGCGAGCGCTCGCAGCATCCTCCGACTACTTCAGCAGAGGAAGAAGAAGGCGAACATC
GGAAGCTTGAAAAGCTTGCCGTCGAGTACAACTTTTTGCTCAAGAGGTGAGCAGTACTTGCTCGTTTGTTGTTCAACCTTGTAGTTAATCTGATGTTTTT
GCTGCTCGTTGCGCTCTAGTCAATTGGAGGAGCAGCGTCTCTATTACGAACGGCTGCTTGCACGAGTTGAGGAAGGCGAGAGCCGACAGCTGCTGAATGC
ACACGAGCACGAACGCAAGCATCTCAAGAAAGCAAATACGACGCTGGCTGAAAAGACCAAGAAGCTCGAGGAGGAGCTGGCGTTTGTAAGGTGCGTGGAG
AAGTGAGAAGTACAGGACTGTTGTTTGGCGATAGCTTGAAAATCGACGCTAATGGGTACATGTTGTCGCGTGTTAGAGAGCTGAACAAGTCACTGATCGA
GAACCAGAAGCAGTGGAAGGAGCGCGTGCGTCAGCTAGAGGAGCACAACGCACGTGTTGAGCAGGAGACAGCATTGCGGGTTGGTGATTTGGAGGGTCAG
GTCCGCGATCTCATGTTCTATCTTGACACGCAGAATAAGGTTGAACATAGTGCACATCGAGAGGATATCGTGGTACGTCTTTGGGTGGTTCTGCATCGGT
GCTGCCAGCAAGTGCAATTAGGTTGACACGCTGTTGTATGTACTAAGGGTGGCACGGTTGAAATCGAATCCAGAACGGTAGCTAGCGAGAAAAGTGCCAC
GACTTCTTCAAGACGAAAGAGCAAAGGCAAGAAAAGGTAGAGCTCACAACTCATGTGGATAGTGAAATGCAGAATTGTACGGAGATTGTCATGGGTTTGA
GACATCTCGAGGCCACGCGAGGTCGACGGCAAAGAGCAATCAGTCCTTCAAGTTTCTATCGATATTCGTTGCAGTTGGTGGAAGATATGGTAGTTATATG
TATCAAAATGCCGCAGGCAACGGTGCCATGGTACGTTTGCTCTCAAACGTGTAATCACGGATTGGAGGGCGACAGGAAATAGTGCGAACGCATATGACTT
GTAAGCTGCTTTCGTGCAGCAATTCCAGCGACGTTGCTGAGGCACTGAGACGACACGTATGCAAAGGTACAACATTGGCAGAAATCCGAGCTTTCAAACC
TCAAGGCAAATTGTGGATCAGCATCGCTTTCTAGACGTCGCGTTTGTTGTCGTTGGACACAATTGCTATTCGGCTGTTGCATCGATGTTAGTCGTAACTT
TTTACTTGCATCAATGACCATCTTGTGCGTTTGTTTGCAGTGCTTTCTGCTTAAAGCGTATAATTCAGATAAGTAATTCCATATGAACAAGGCTGTAGGT
ATCATTTTATAAGCTATTTCAGCCATGGTTCCGATCATATCATCTGCGTCTGTACGTTGTTGTAAGCTTACCATATGCCATGCTTTTGGCTCGCAAGCGG
TGAAGAAAGAGGGTTACAGCAACTGGCCGTTCACATTCATGAAAACTTGACAAGCTATCGTCACACGGACCGTGCCTTAACGGGGTGAGAATGAGAGTTG
TATCATCTTCGTGTCATCGCTGACGTCAAAATGTCAGCACATGGTGCCACAAGAAGCTTGTAAATTATCAGTAATGTAGGCAAGGGAGATCCGCGCTGTT
GCTGCTACATGGGATGAAGCGAGTCAACGACAACTTCCAATCGTAGCAGTTGTGAGTTTTGCTTAACTCTTTCGAAGAAGTACGAGCCACAACGCTCGTT
TCGAGTTGAGATCTCCTCGTCCGGTCTATTGTATCGAAGACTTTGG