Description :
From Genome Similarity Track
Location :
Scaffold_69:47129- 49456
Transcript NameFunction/comments
Phyta_totarag2819conserved hypothetical protein
Phyta_totarag2820hypothetical protein

Sequence
2327 bases(100 bases per row)
tATGTGCATGCAGCCGACAGTGAAGGAGGTGCTCCACTTCTTCGTGCGGTGggccgctgctgcacctcaTGACGTCAAGTTCTTGGGTATTATGAACGGT
GTCGACATGTATCAACAGATCTCGCGGGTTCATGTGACTCGTGAAAGCGCCACTGATTCGCACGTCCCTCGTGTGGTTTTTGGATCCTACTCACACCAGG
ACCTGCTCCTTATCATGCAAAGTTACGTGCAGAATGCACTGCCATCAAGTGTGGACATTGGAGAAGTCTCCAATTTTATCGAACCGCGTGCAATTGAGCT
CATTGCAAGGAAGGTGGCAGCCCGTGATGGTGACGCTCGTCTGGCCgtcagcttgctgcagcagtcagCCCGTCTTGCGCTTCAACGCTCCGGCAACTCG
GAGAAGAAGTCTTCAGCTCCGAATCAGGTAAAGGTCACGATACGTGACGTGTTCCAATGTGCAACGTCAATGCTGTCGTCTCCGGTTGTCCAGCAAATTA
AGCAGTTACCAAGACAAGccaaattgctgctgtacgtGATCACCGCTCTCGCCCCGGGTACCAACGAAAACggtggcaacagcagcccCAGAGGAACGCT
GCAGTGTGAGATGAACCAAGTCAGCGAGGAGCTGGCTCGCCTGCGTGGCGTGCCGCAGACTGCTTGGGTTCCTCGCTTATCGCGTGAAGAACTACAGACG
CATCTGATGTCGCTTGACTGTTACGCCCTGGTGAGGCAGGGAGGCAATAAGCGCGGTGATAAAACGTCTCGACCTGCCGCAGTCATGTCGGCTCGCGCTT
TCTGGACTACAAAGCTCTCCTCCTGCGTCACGATGACTGAATTGTCGGGGGCACTTCAAGATGACACCGCGCTCTCTCAACTGCTCTTGTAGTATCCAAC
TATCAACGAGAAGTACGGTACTCTCTCAGCAAAAAAACTAAACACTAATCAAATTATTACTACTTACTACTTCGACTTGCTTTAGTTTATTCATCGACGT
CCTGTAGTTACGGTAGCAGTCTCCGTGTGCATTTGGCGCTCGAGCGCTTTCTGTGCCTTTTGCACTAGCAGCGCAAGCAGGGACCGGTCTTTTGCTGGAC
GCTGTTTTAGTTTTTCCGGTGCCGGCAGCCGCTTGTCCACGGCGTCCTGAACAGCACGCGGCAGTTCGCGGGAGATGAATTTGAGAATCTCCACACGATA
CATGCAAGTTGTCTCCACATCTAAGAGCATCGGGTCCGACGCAGACGTTGGCGCCTGTAGCAGTGAAAGCTTCAGACGGATATCGGACCCCACAGCTTCT
GCCACGGCGTCAGCATCGGCTTCACGGGTTGGTTCCGTTTGGTCGCGGTGCACGCGCAAAAAGCCCGTAACACGCGCAGTGATGCAAGCTAGCAGGTCGG
TGCGGATCTCCGAGGCAATACGACTTAGTTCTCGAACCGCTACGTCCTCTGGAGAGCGGACACCGTATCCTGTCTGAGGTTCCGAAACGGGAGTAGCTGT
GTCTACACGTAGGCGTTTAAGCGGTGAGCGGTTTGCTGTCGGAGATGGTTGGTTAAGTGGAGTGGTTTGGTACCAACGTGGCTGGTTCCTGTTGAGCtgt
ttctgctgttgctgactgTACGAAGGAGTGCCCACGTAGCTATGACTGGGTCGTGGACTCGGAGTCGGTCGACTACTAGGGCTCAGATTCACCATCAGCG
ACTGCACCGGTCGTAAATGAAAAGACCTTGAGGCAGGAGTCCGAGGTGTCCTGATGTCACGCGGTGTACCTTGCGGTTGAAGTCCCTGACGTAGCTGTAG
TAACGCTAGTTGCGGTCCCGTGGCACTGGCAGTAGCTGTTGGACTTGGTAAAGCTATCGATGGCAGGGATTTGGGTTGGCCCTGAGCTACAGAAGGAGAA
GTAGCATAGCCAGCAGTCTCGTTGTACTCGTGTCGGTTCGCGCTTTTCCCTCCATCATTCTCCGCCCCGCTGCAacgttgcagcagcgtctgcaacagAT
TGGTCAACTGCTGATTGGTCCTCTGCATCTTGTGCATCTCCTCGCGCAGTCCTCCCACCTCCGCTCTCAactcctcgaactcgacgCGGTCCACCGGAAT
ACCAGCCCCTAGCGGAGGATTCGACACCTTTGCTTCGCTAGGCGACCTTCTTCTGATCTCACACAGCAAGTCTCTCCTGCCCCTCACAAACCGATCATGA
CGGAACTCCCACCAATCCTTGGGACTTGCGTcctcgacagcttcagcgtcagcatcagcttcagctccaggTTCAgtctcctccaccgccgcgGACGTGG
CACGCACCTTCCTGAACCCATACAGGT