Description :
From Genome Similarity Track
Location :
Scaffold_75:47117- 54728
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_75-snap-gene-0.25Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_75-snap-gene-0.36Conserved gene of unknown function

Sequence
7611 bases(100 bases per row)
CCGCAGGGTATGTTCAGGAATGCGTCCACTCGACGTCCATCGGCGTGGACGCGACCTTCGTCTTCCTCATGCAGCTCGTGGACGAGCTGGACGACGCCAT
CGCCGAGTTCCTGCCGCCCAACGCGACTGGCGACGCAGTGCTCGCTCACACCCACGAAGTCGAGCTCGGCTCGCTGCTCTCGGCCGCATCACTGGTGCGT
TTTGCCTTGCAACGCGAGCATTGACAACCATGCAATTCATCGCTGACCTTCTGTGATTGTGTGTCCGTCAGACTGTGCGGTATGTGACCGAGAAGAAGGC
CATGCTGCCTCTGCTTGAGCGCTACCGCGCCGCATTCGGCACGGTGCTGGATTACCCGTCGTGGCGCCACGATAGCTACCTCGGACTAAAGTCGGTCGCC
ATCTCCGGTGCCACCCGCGTGCTCGAGGCGTTTGGCGATCAGGTCGCTGCCGAGGACGCTGACCGGCGACTCCGCTGGCTGTTTGCGCTATTCCGATCGG
ACGATGAGGCTTCTCAGCGCCTCAACTTCCTGCTGCGTCCAGCCTGCGAGTACGCGACGGTGGCGATGCAGACGCACCCGGGTGTTCGCCACACTATCTT
CAACGAGGTTGGCACCAGTATCATGAGCTATCACCGCTTCATCTCGGTATTAACGTACTGCTGATTGTTGACAGGTGCTGGCGGTGCTGATGCAGCTGCT
GATCAAGCACGGCGGTGCCCAAAGCGGCTCGACGACGGCTGTAAAAGTCGAGCTCGCATCCACAATCGCTATCTTGCTGGATGTGAAGCATCCACATGCG
CCGGTGAATCCCTTCACGCTGCTCCGCCTCCCGTCGTTCGTCGAGGAAATGGAGCCGCTGGAGATCTCAGGGCCGATCGTCGACGAACCCAATAGCGCTG
CTGCTCAGCCTACTGATGACGAGGAGAAGGCGATGGCGTGCGTCTCGCTCGACCAAGAGCTCGAGTGCGTCAAGGTGCTGACGGCCTGGCTGGCGACTCC
AGACTGCCGTCTGATCGCGGCCCACACGCTGCCGATCCTGTACCGCGCCGTGATGGAGACGTCAGAAGCGCGTGGCGAAATGAAGATCGGCACTCCTTCA
GGATCGTCTCCGACCGAAGAGATCATCCAAAGGCAAGTCTTCGTCGCTCTGTCCGAGTTGTTGATACGGTTGACTCACAATTGGTGTGGTTCTTCAGCCT
CAAGGATCTATCGTTTTCGTCGCTGCTCGACTTTGAGTTCGCGCTCGCGCTCGTGGAAGGGGTGCGTGATATCTGCCTCGGTGACCAACGGATCCCGGAG
ATGGTGATCGAGTCGACCTTCTGGGAACTTGAAGGCGTTATGCCGCGGCTTGAGGTAAGCAGTATGTGCGAGTTCATCGTTGCGAGGTGCTCGATTGACA
GGTTATTGGTTCCAGGTGAGTCTGGCATCGTCAGCAATCGGACCCAGAGAGGCCCGTCCGGTGAAGGCGGTATGCTCCAAGATCCGCCACGCCCTCGTCG
AGACGTTCCTCGCTTGGCTGCATCACCACAGCTCGAGCAAGCTACTCGGCCTCCATGTCCACTTTATCCAAAATGTCGCTGGCACGCTCGCAGACCCTCG
TGTGTACGGAGATGCGCTCGCTGTATTGCGGACGTGTTCCCACCGCGACGCGCCGGAGAAGTACAAGGCCAGTCTCGAGCTGTCTGCCGTCACGATATGC
CGCGCGCTCGACCAGATCGATCGCTACTCGAAGGTTAGTATCACGAACTGTACGATATCGACACGAATCAACATCTCTGACGGCTTTGCGCTTCAACAGG
GCTCAGCGAACCGGATCGTCTGCGGGTTGACGCGCATCGCAGCAGCATGTGAACAGGACCTGCTGCAGCTTGCGGACGAGCTCGTGCGGCCGTTGCTGCC
GTCCATTCTTGACGGCTCTCAATGGGGAAAGTTCCTCCGTATCCGCACCGAGGCAGTCGCCACGGTCTTGCTCGGCTGTGCAGGGGACGATCGCTTCCAG
GTTCGTTCGTCGCTGATATTCCCTTTTTCATAGCTCATGCTGACGCTCGGTTGTGAACTGACAGCTTGACGAACACCCGTGGGTGAAAGATTTCATCGCC
ATCCTTCTCGATCCGGTCGTGTCCTCGGAGAACGCGCACTCGCTCATGATCCTCGACGTTCTGATTCAGAAGCATGACAAGCTGCTGCACCGCGTGGCCT
CCTTTTGCCTGAGTCAGCCTCACACAGTCTCGCAGAGGCTGCACGAACCGCTGCACCGGTGGCCCATCTACGAAGAAGACATTGAGCTCGTGGTCGTGAC
TCTACATCTCATGAAGTCGCTGCTCAAGGTCGAATCGTTGCGCAAGTCACTGGACGCGGACGTCATGTACGCGACCATCCTGCAACTCGCTGACAACGCC
GAGGCCGACAAGCTCGAAGCCGTGGCGAGTGCGTGTCGAGACGTGCTGGCCCACTCATTGTCGCCGACCAAGTAGACGGATACTGGTTCTCATTGTGGGG
CGATTTCGACAGGTGTTGGTGGGGGCGGCAGAACTATTTCACCCTTGGTGGTCCAGGAACACACTGGCCAGCTGAACTGATTCGGCGGCTGAGCGCACGG
AACGAACGTGTGCTCGTAGATGCAGCCCGCGGCGGAATAGATCTCGATCCGCGGCCGACAGAGGTGCCACGGATAGAAGCGATAGAGGTTCGGGGCGACG
ACACATTGGTATGAGAAGCCTGCGGGACAGAACGTAACAATAGAGAGGTCAACCATCGGCCACCATATTGCAGTCCACAGCGACCTGGCGCTTTCTTACC
GTCACGGCACGAGAGAGAGATGGATTGATATTCCCAGTCCTCGAACCGCCCCGTGCGTTCTAAGGCGACGTGGTCTTGCAGCTCGACAGGGGCACCCTGG
CGCCAGGCATATCCCAACGGAACCTAGACAAGTGCAATTAGCGATCAAATGGCGACCAATCACTCTCATATCGAGAAAACTGCGAGTTACCTGATCCTTC
CACACCTCTACACTGATACCAAAGTTGAAATTGTCGACAAGACAGGAAAACACGACCCGGAAGCGCTTCGGCTCATGGAAAGCTCGAGTCATCACGACGA
GTTGTCTAGGCTGAGTCTGCGCTGTTCCCCACTCGACCACCATCTGTGTCGTAGCCGCGAAGCATCCTGGACTCTCAGCGCTTAGTCGATACGCTCCAAG
TCGGAGCTGCAGCTGTCTCGAGCTGTTCGGATCAAACTCTAGCGCCATCACTTCGGTCGGTTCCCCCTCCTTCTCGTCGCTTGGCTGCAATAGACCACTC
GCCCCGCTCAATTTGAGCAGCTCGACTGATGTAAGATCTGCATCTTGGTCATGAACGTTTACAATTGCGAGTGTCACCTTGATCTTCCCAAACAGCACGG
GAACACAGATAGTGCGCGACGCTCGGAAGCGACTGCCTTCGACCATGATGTTCTTGAACGCTGAATAGAGGATGCACGGACAATCTTGGGAGGCGCTGAC
CGTGTACAACCCCTTGCGGACATCCCAGGCAGCGCAGCCGGTTGCGCCAGTTGTCGCTGTCGAGTGCTGGGAACCGCACTTGTCTGTGATCTCGAGCGGG
ATGCCCGCGACCTTCTTGGCGACCTGCTGCTGGTAAAAGTCGACCAGTTGGATGTTGTACGACCAGCGGAACTCCTCGAGCGGAATGAGGATCTCCTGCA
CTCCGGACGCCGCCGCGGTGGAGCCAGCATACGAGCCAGTTGTGTTGCTTGTTGGGTAGATGATTATCACCGAAGTCCACTCGAAGTGGTCGACATGAAA
AATGTAGAGCGTGTATGTCCCTGGAACGAGGTTGCACTTGACGACTCCGTGCTCGTCCGTCACAAACTGCTTCTTTTGTAACTGGAGCGCCGAGGTCGGA
TCAGTCACGCCGCGGGCTGTCGACAACTGCGCTAGCTCCTTCAGATTGTGAGAGTTTGCGGTCGATTCGGGTTGATTAGGGGTGACAACTGTATCGTTGA
CATCTTCTTTTTGCGGTTCTTTCGGCTCTTCTTGATGCTGTTGCGCCTGTAGCTCGGCAAGCACACTGGACAGCTCGGGAGGATCAGAGTCAGCCTGGTC
AGTCGTCGGCACATCGTCCAGAACTTGAAGTCCATCTCGTGAGAACCACTGCATCAAGTCTCGCTCGCTGTTCGACCAGTCTAGAGGAGCTGTCAATATT
TGCTGCAGCCTCATCGGCGCATTTCGCGAGTAGATGCGAGTGTGTTCGCTCAGCTGTACGGCGTCCAGAATATTGTTGCGAATTTGATCGTACCGCCGAC
GCATGGCCATTCGCAACAGCGTCCGCGAACGTATGAATGAAAGCAACGTGGAGTCTCGTCGGAGCGTCAAGAGTGCAACTCGACTACCCTTCTGAATCGC
CTCCTCAACCAATTTCTTCGCCACGCTCTGCACATCCATCATGAACCGGTTGTTCTGCAATCGTCGGCGGATCGACACTAGACGAGACCCCATCGTGAGC
GTCGGAACAATCTTATTGGCCAGGCTCGTGCTCAAGCTGCCATACTCGAGATTCCGCTCGATAAACACGTGAGCATCAGCAACTGGCTTGTTGGTGCGGT
CACTAACCACGTGGATCTCCACACACCGCTTTATTCGTCGGTCCTTGGCGATGAAAGGGTTGTGTTGCAGACTTTCTTTGATGCCGTGTGTTGCCAGAAC
ATCTAACAGCATTCGGTAGATGATTTGAATGGTGGGCAGAGCACGATGGCGATTCTCGTGAATGTAAACATCAATCTCAGCGTCAATATGCTGCAGCTTG
AGTGCGATTCGAAGCGGCGGACGCTCTTGTCGATCTCCTGTCGACTCCGAATCATTGGTCAGAGGCAGAGTGACGATACACCCGCTACGACCAAATCGGA
CGCACTTGGCAAAGCGTGCTGCAAACTCGGAGAACTCCTGCAAACCGCTGCTGGTAAGGTAGTACACGCGAATCTCGTACGCCTGGATGATTTGGTAATG
AGCCAGCAGTGTGTTAATCTCTTCCACACTCGAGGAAAGGGAGTTCGCAAGACCAGAGTTCCCTAGAGCCTGGAACTGCCACAAATTCACCTTTTTGGAC
CGGTACAACGCCCCCAGCGTCAGCCACCGACATGCCGTAGTCGGAATCACATCAAACATGCCGAGCACATGCCGAGTTTCACTGTTGTCGAACTGGACGC
GGATCGTTTGACCGCATTTGCTAGTCGATGGGACTGACGAGCCATTGTTGGCGATATCTCCACCGATTCCGGTCGTCTTCATCTGCGAGATCAGCACACA
GTACACGCGGGATTGCATTGCGGTCAAATCGAGCTGGAGGCGATCGACAAATCCGCCGTATAGATATCGGCTCTGACGATACATCACTAGTCCTCGCTGG
GCGATCGGACAATCCTCGCGAACAAAGTCCACCAGTTGGAAGTCGTAGTCGAGCAGCAATGCGATGAATTGCCAAGGCGATTGTTTGGTGCTCCTTTCGA
TGGTCAACGTACAGGAAATCGAAAAGAAGTTCATGAACGGAAGCGTGTACGTTCCGTCAGCCGTGGGCGGCAACATGGACAGACTTGGCAGATCTTCGAT
TCGACTCTGGTTGCGCGAGTAGTTTTCCTACAACGTATGCATTGATATCAAAAATGAGCACGGTGTTGAGACAATTTGTAAGCATTACCTGAACGGTTCT
GAAGTACTTGACCATTTCCTGCGCCTCCGAAGCCGCGAAAAAGAGTCCGAGCTTGTGGAACAGTCCCGTGATCTTGCGCTCAGTGATCACAGCCTTGCGA
TTAATCACTGATTCCAGGAATATCCGCTCGCGATTGTGGCGACTGCGCTCTGCCAAGGCCAAAAAGTGTCGAATGGCTTGTGTGACGATTTCTTCTCCCT
GAGGACTGCACGAATTGTAGTCGTAAGCGCAAGTCGGATTCCAACAAAACAGAAAGAACAATCATGCATACCGCTTGGCCTCGAACAAGACAATCGCCTC
GATCCTCTTCTTGACCTCGACCTCGTTCGGGAAGCACCCCGTGCTGGCCATCGAGTGGATCTCAATACTCACCGGATCTCGACCTATTGCGCGAGTCAGT
TCGACCCTGATTTCGAAAGACCCAATCGGCGGCTCCACAAACGTCCCCGAGTCTTCCTGGTTCACCAGCACTGTGAGCAGCGGACTCATTTGCTCGATGC
CGCGCACGACAGCCAATGATTTCTGTTCATATTCGGACCGTGTTCGACATCCGTACTCGTTGCTGATTTTCAAATCGAAGTCCAGCGCGAACTCGATCAC
AACACGAAAATCGCCGGCTTGAACCACCGACAGCAATAGATTCTCGAACGATTTCGGATGTGGCACGGCCATATCGTTGTGGCCACCGTGAAAGAAATTT
CCCAATAGGAGAACGCCAGGCAGCGACTCGGAACGGAATGGCGGGAACTCTTGCCGCCAGAACACGGCGCGGCGGCAGTGAATCGGATGGTGGAACCTCG
ACGCGTCTCGAACTTTGCCGATCCCTGCAATGTGAAGAGCTACGAGAACTGTCGTGCGGCTGACGAACTGCTCAAGCGAGGGAACAGTCGGAAACGGTGA
TCCATCTGTCAGTCGAATATTCCCTTGCGATGTGTTGGCAAAGGCAGGTTTACACCCAGTGATTGCCGGCGTATTCCCCACACGCAAGCTGAACGCTCCA
ATGAGTCCAATGAATCCATTCTTCGTCCTCCATTCCCTCACGTGCCTTGAGTACGACGGGTGACCGCCGATATAAATCGAGCTGGCACTCGAGAGAGACA
CGACCCAATCGGAGTCTGCTCGCTTGATTCGAGCGCGTGACGATTGAGAGAAGAATGCGCTCAACGCGTTCAATCGTTCTGTGGAGCGAACATCAGCGCT
GTCGACGAGTTCGCCGTCAAAGTACAAGTGAAGGAATCGAGTATCGAACGCGGCCGTGACACGAATCCACCGGTTACTGGGGATGACATACGAATGTGCC
CAGCACTCACGATGATGCCACCACAAGCGACATCCGCTGTCGCGCTTGTCGGTGATGCCGCGGTCATACAGCAGAATGCCCACTTCTCGCGATTGCTCCT
GGCTCGGTTGCTTCGCGACCAGGAGCTTTGGCGCTGGAGCGTCTGTGTCATGAACACACACATCGAACATGGTCAAATGATCTTGCGTGATCTCAGTCAT
CAGCCGAGGAGCGTTCACCAGTGGGTGTTCCTGAAGAGTTGGTGGCTGTTTTGCCGTCCTTCGCAGCGATCGAACAGCCATAGACGCTGGGATTCGTGCT
ACCACAGCATGTCCAGCGCATGAACTCGCCGGAATCGTCGATCTCTGGGTTCTGGTGCCGATTCTCGTCTGATTCACTGTGGTGTCACAAGCAATGCACA
CATACACGCATGACGATCAGCAATTCGACTCAAGTCTGGACGGTAGTTGCACATACACAATGGCCGAAGTCTTGGAGATGTCAGCCGCTTTGAACACGAG
TAGCTCGATAACAAAGCTGCCACCTTCTAACCCGGCTCGCGGACTCTGCAGCGGCTGGCTCTCAGGCTTTAGCTGCACCTCGAGGAACCCATCCCCATAC
AATGACAGCAC