Description :
From Genome Similarity Track
Location :
Scaffold_82:47101- 48382
Transcript NameFunction/comments
Aphas_H257_15580PREDICTED: probable RNA helicase SDE3-like
Aphas_H257_15581Hypothetical protein

Sequence
1281 bases(100 bases per row)
TTGAGACGTTGCTGCATGAGAAAAAACGCGCGCGGCGACCGCGGCGGTGTCGGCCGAGGCATGTAGCGCGGAACCGTGTCCTCCACCAGCGTCGTCAAGG
ACGCATGCAGCGGCAGGAGCTTGCGCGGAAGCGTCCATGTTGGCAACGGCAGGTTGAAAATGGATCGGAGGGAGTGCGGCACGAACGACGGCGCGTGGAC
CGTCATGGCGCGGACATCTCGGGCATGGACATGGGCTAGGCGAAGGCGAACGCCGATGCAGAATGTGTGGGTTGAAAAGTCAAACACGCTCATTTTCTCC
AGACTGGGCGGCGTCTCGCACAGGACGATCATCCAAGTTTCGAGCACGCCCATGGGAAGTGACGCCAACAGCTCCGTGGATAACCCCACCTAGGCACGCC
ATGATGCCTGGGTTAAAGAAGGAAAGCGACCCACGTACGCGAACTTGGATCATCGCTTGGGGGTCATTGGTCGTGGGCCGGTCGATCGTAAATGTAAACG
GATGCGACGCATCCAGACAAAATACGGAAGAGATCGTGGACGACATGGATTGGTTGGACACAGATACTGTCTCCGTCGCGTCGCGGCCTCGGACACATGC
TCCATTCTTCTTCTTGTGGTTGATGGAGCTAGGTAGACACATGTCTGAGACGACAGATTACGCCTCATGCTAATGGGTACCTGTCCTTCGAGTCGATGTA
GCCAAACTCGATCGCCGTGACAGGGTGTGTGGTACCTTGGGTCGTCACCTCGATGCCATAATTGGAACTTGGCAGGACATGCGCAACACCAGGAGGACGG
CGCACCTTGATGGCCTTGCGAACGGAACTTGTCCATTCCTCCGTTGCCATTTGCTTGACCTAGACACAACCACATTCGTCAGGCGTCGCCATTGCTGCTG
CCGTACGTACGTACCCAAGTCGGCATTATTGTCGTCGAATTCAGGACTGTCCTCCACGTCAGTGATTATTCTGGATCGGCTTTGAAGGCGATGCGGATTG
GCTGAATAATCACAGCATGTCCAATGATTGGCTAAAACGGGAAGTGTACTCTACAGCTCCCGGTAGTAAACTAGTACTACTACTAGTAAGTACCGTACGT
GTATAATCAATCAGTACTGTAAACTCAGAAATCGAAATGCCCATAGCGGTTACGTGTGTGTGTGTCGCCGTTACGTGCTGCCCCTTCGACCGCATTCAGT
TGCCGATTTTACTACGTGACGTCGTGGGCTGATGGAAAAGAAGAAAAATGGGGTTGGCTCGGTGCTGACGGACGACTGGGA