Description :
From Genome Similarity Track
Location :
Scaffold_684:471- 6265
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_684-snap-gene-0.7Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_684-snap-gene-0.9CAMP-dependent protein kinase, regulatory subunit 2-1
Pytul_var.sporangiiferummaker-pug3_contig_684-fgenesh-gene-0.2Bromodomain containing protein
Pytul_var.sporangiiferummaker-pug3_contig_684-snap-gene-0.10Conserved gene of unknown function

Sequence
5794 bases(100 bases per row)
ACACGCACTGCGTGTTCGTCGTGCAAGTGGACACGGGCGCTGAACAGTTTGTGATCCAGAAGCGGTTCTCGCAGTTCCGCGCACTGCGGCAGCAGCTCTT
CGCGCTGCTCGAGGCGAACAGCCACTGTGGCAACGGCGCGTGCAGGCAGCTCGCGCAACTCACGCAACTCAAGTTCCCGCGACGCACGCTCCAGGTGTTT
GGCAAGAAGAACGCCGACCTCGCAGTCGCGCGCGAGCGGCTCATCGTGCTTCAGCGCTTCGTGGACGCTATGCTACGCGTGTACCGCATGGCGCCCAAGC
GCCAGCTGCGCTGCTGCGCCAACACCAATTGCATCGCCCTGGACACGATCCGCGCGTTCCTAGAGATCGTTAACCCGGAGAACCCGCTCGCCATGTCGAA
NNNNNNNNNNNCAACGACTCGGACTTCAAGACGCCGGAGGAGCGCAGCTCCAGCAGCAGTTCAACGTCGGAATTGAACTCGAGCGGCGTCAACAACAAGC
GCCGCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCAGTCGCCGCACGAGGCCGCGCACCAGTTCGAGCAGCT
CTACCCCATCACCGAGGATACTGAGCTCGTGCACATGCACGCATAGACCAGGTAGTTCTGTCCAGACAAGGGGATCTGAGAGCATATATCCCTTTATAGC
CACACACAATGTTGGCCAGTAGTAGTAATGTAGACTGTAATTTATCATAAACCAGAACACCCTCTTTTTTAACTTTATACTTAGCATATAGCGAGTCGCT
ATTACGTGTCGTCGCTGCGCGTGAACAAGGACACGATGACGGATGTGACTTTGTCGTCGTCGCCGCCGAGGCCGCCNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGTCTTGCCCCACTGGATATTGCTCGTGATCGCCTTTGCAGACAGGCAATATGCACATATGTAAAGAGTAGATAGAGCCTATATGTGATA
AAGAAAGAGTTGATAGACAAACGCGCGTACCTGGTCGTCTGGCGGATCGAGACGCTCGCCATTCCGGCCCGTGACGATCTNNNNNNNNNNNCGCGCGTCT
TGGCCCACTGCAACGCCATATAAACACAATATAGCATGATACGCGCACATATAACCACCATAAAGACAGAAAAACAAAAACACACACGCACGCACCTCGA
GCCATTTCTTGTCGCGCGCTGGGCCGCGCTGCGGACTCGAGGGGTTCGGCACGAGGATACTCGGTCTTCGCTGCACATTCTGGTGCGTNNNNNNNNNNNN
NNNNNNNNNCGGGCGTCTGGTCTCGTTGGTGACCGCGCACTCGTGCATGTGCTGCTGCTCACGATGGAAACGACTGCTGGGACGACGGGCGGGAGCCTCG
GACTCTGAGTGTGGCGGTTGGAACGGATGGCGCCCACGAGCTCGNNNNNNNNNNNNNNTGTACTGCTCCCAGGCTGCATCGACACGCAATTCCTGCGCGA
CGCTGGAGGCGTCCATGCGTCCGCTGAGCGCCAGCGCCTCCTGCTTCAAGAGCGACTCGGTGGTGACGTCCTTGAGCGCGACGTGGCGGAACTCGAGCNN
NNNNNNNNGACGCGGTACAGGATCGCTGTGGGCGACGACACGAGCACCGAAAACTCGGCGTTGGCCTTGCCGAGCACGATCTCGTACGCGCCGACGTAGT
GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGTGCCGGACGACGCCTCGTTGGCAAAAGTAGGCCATTTAG
TGTCCTGCAGCGGTGGACGCTGTGATGACAAGTTGAAGCGCTTGACGAAGCGACACTCGCCATGGCGCACAAAGTAAAAGTAGTCTGTAAGTGTAGACAA
AGAAGGCATTAGAGCAGCTTTCAGATTTGCTCTGTTCGGTACGTCCACGTACTCGCGAGCTCGCCCTCGCGCACGATGACGTCGTTGTACGAGAACACGA
CTTTCTCCATGTGCGTGCACAACTTGAGCGTCTGGTTGGTCCCCCAGTGATCGAAGCCCCGGACGCTCGACAGGAATGTGACCTTCTCCCTGTTCGTCAA
GTGAGAGGCCGTGAGCCAAGCAAGTGCTTCAAATGAATGCGCGGGTTCCCATTACCTGAGTTCTCGGCCGATGTTGGTGCTTCGCAGGTCCAAGAACGTC
TCCTTGTCGATCTTCATGAGCAGCGTGCGCTCATTCGCGACGACGGACGCCGTGCGGTGTGGGTCGCTCAGCAGCAGCCCGACGTCGCCAAAGCACTCGA
GCGGCTTCAGCGTTCGCACGACATAGTTGGCGTCCTGCGATAGGTCTACATTGTCGTCACAGTTCCGTTAGTATCCCATCGCAGTTGACTTTGTTAGATT
CTATGCGTACATCATACCTTGCGCGCCGCCTGGGTTGAGCAGACTCGAATGTACACGTGCGCGCGAGAGGATCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTTCAGCGTCGGCACCGCCATGTGCGCAAAGTCCATCACGACGTTCAGCGAGCCGTACATGACGCAGTAGAACGCGTCGGCCGCGTCGCCGATAT
GGAACAAAGCCTCGCCCTTGTCGATTTCCATGCCCTTAACGGCTTTCAGGTACCGCAGTCGCTCGCGCGGTGGGATATCGGAAAAGTAATTAACATAGTG
GACTGCAGTCACCATTCATCAGTGAGTCCCAAGCATCACCAAGCACGTGGCGTTTCTATAGAGTACTAAAGTTTACCATATTTGTCGAGAAACTCGTAGT
CTTCTCTGCAGCGCGAGGCGTCGGAGGTCAGCAGGATGCGCCGCAGCGTCGTGCGCACCTCGGCCGTCGGAGAGTCGCCATCAAACCCGATGCTTCGACT
GATACATACACACACACACACCTTCGTCCAGTGAGCTTGGCATGTAAATGCTCAGTCCTGCCATTGTTCACGTACGGCCGCATTGCATGCATCACTGGCG
CCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAGCCATTGAGAAAGTACACATGCTCTATAAATAACCCAAAGTGTACCCATGTTGTCAAC
AAGTTTGACCCAGTAACCCAAGTCACCCGGATTAACCCAAGAAAAAAACCATTTGCACTTTTAATTGGTGTTCAGTGCCACACTAACCAAGGGCGATGCT
GCGGTTTGGCGCGTTGCGCGAGGCTATTTTGCCACAAGCAGCAAGAGAAAGCAGGTATGCTCACGGATGCCTCCGCTCTCGCTCTGTGTGTGTGTTATTC
ATGGGAGTGCGCGTATACATAGCTGAACTATATAACAAGAGACGCCTGCGCACGTGGGACACGTGGATCGAGCGCTTGTTGCGTGCCTTGGGCGGTCTAC
TTTGCACGCGCTCATGTGTGTGAGGAATGCGCTGTGATGTATGAAGGAGACGAATATCTCACTTACAAACGTTTTTTTTCCTTACAAAACGCGCGTTTAA
ACACAAAGAGCCGCAGATATGGACCCCGAGCAGAAGAAGAAGTGCAGTGAATTGCTCGAGTATTTTTTTAAGCTCGACAGCACAGGTGCGGCAGTTGGAC
CAACGGCCATGAGCTCTCTATAATGGCGAGAGTGCTGACAGAACGCGAATGTGTTCATGCGCTTGTATTGATGCGAACTGACCCACGGTAGAGCCTTTTC
GGGAGCGCGTGAACTGGGAGGAGTGGGGACTCTATGACTACCTGCAGGTGGTGAAGATCCCGATGGATCTTGGCACTATCCGCAACAAACTGAGCAAGAA
CGAGTACAAGAAGCCCGTCGAGTTTGCGCGCGACGTGCGGCTCGTCTGGGACAACTGCAAGCTCTACAACCAAGTACGGCGGCAACATTGCACTTTTGTG
TATACCTCCTGCACATGGGGATTGCTGATGTTCACACCTTGCATTATGTGCGTGTGTGTATGTAGGATGGCTCTGAGTTGTACGACATTGCCGATGGACT
TTCCAAGAAGTTTGAGGACCGCGTGAAAGCCATGAAGCTCGATGTCGGCACTGCCCCACGTGCTGACAAAAGCGTCCCGTACGTTCCCCTTGTCGTCGCC
CATTTTGCAACACTCTTTCTTTTTTAGCCCATGATGCTGACAATTCACTTTGCTGTTTGCTTGAACCAACTAGAGCGCCGTCAATCAATGAGAAGCTCCA
TTTTAGCCAGAACATCTACAAGGTGTCCACGAAGGATCTGGGCGCGATCGTCGCGATCCTCGAGGAGAAATGCCCCAAGGCTTTGGACAAAGTGCGTGTT
TTTTTTCGTGTTGATGGCTGATGATTTGTGCATATCACAACGCTAAATAACGCACGACTATTGCTCTTTTTCTCCCTTAGAGTTCGACGGACGAGTTGGA
TATTGTGATCGACTCGATCGATAACAAGACGTTCCGCGAACTCGAGACCTTTGTGATGGAGCGCGTTCCAGAGGGCAGCCGCGAACCCGTGACGACGCCA
AAGTCGTCCAAGAAATCGTCGTCGTCGTCGAAGCGTTCATCGAAGGAACCTTTGTCCAATTCGGCGTCCAAGAAGAGCAAGATCAGTGAATAAGCAAGCG
CAACAGATTTTTCTGTTCATCGTATTCACTTTTATCTCGATATTATATGGAAAGCAGGAGAGAAAAAATGACAGGGCATGCTGTATTGGTTTATGGTACG
TGGGTGAAGAACAAGGTGGCTATGCTTGAATGAGTACGGACTGGTTGGTTTTTACTTTTTGTTGAGCAGCGTCTTTGCGAGTCTCGCCTGGCGTTGGAAT
GTCATCTCAAAACTTTTCCTCGGCTTGATGTCGTCGTTATTGTCGCCTGCAAGCCCGACGTTTGCCTTGTTCACAGGAATAGTGCTGTTCCCTGCGTTTG
CCGAGAGTTTGGAGAAGTCCAATACTGGAACCGGCGCCGTCGTCGGTGTCTGTAGGTCAGAGGACGGAGAGTCTGCGTCTCGTGGTGCAGGCTCGTGTAC
ATGCTGCTGACCTGGAGAAGAAAACGTATCTCGCTTAGGTTTCGCTGTGGAGCCAGCGACGCGACGAGTGGATTGCCATTGGGGGGACACGATCTTTGCC
GCTGGAAGGCTCGAGGAAGGATACTGCTTGAGTTCGTTGCTGTTGAGAATTGGAATACTCTGTCATAAACAAACAAAAGTCAGCCAACACGAAGTGAGGG
AAAAGACGAGAAGCGCAATAATCGTGGATACCTGAGACGGCGGGAGCTGCATGATGCGAGATCCACGAGCTGACCGCCCGTGAGCCGAAGAAGACGAATC
TCTGTTCGTCGCGATGGAATCTTTGTACTCCAGAAGCTCCTCCTTATGCAGCTCCATCAATTCTCTGCAGGGAAGTAGATTGTGGAAGAAACGTCAGCAC
AGGGAGGATAACACAGCGAATTCTTTCGCTTGTGGCTTCATACCTGAGCGAGAGTTCGTCGCCATTGGAGGCATCCCATTTCTTGCCGTGGACTCTCTTG
CCTGCTTTCATGAGCTTCCGCCATTCCTGCAACGTGGTACGTGATACCACCAACATCCAACATGTACACATTTTTCTGAAAATGAGTCTCACTCCATGTG
CGCAGCTTTAGATCTAAAGCACCATACACACAAACCTTGTCCTGCTCGTGAGATTTCTCGACACGTGACGTGACAATCTCTTCGAGTTCATCATGATATC
GCAACTGCTCCTCGCGCTCTGCTAGCTGCGCTCGCAATTTGCCGATGAAACGATTCAAGTCGTCCTTGCGGCGAGCGATTTGGGTCAAGACCCC