Description :
From Genome Similarity Track
Location :
Scaffold_1148:471- 3506
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1148-snap-gene-0.460S ribosomal protein L35a-4
Pytul_var.sporangiiferummaker-pug3_contig_1148-snap-gene-0.6Ferric-chelate reductase

Sequence
3035 bases(100 bases per row)
AACCAGCATGCCCACACCGCCCTGATCAAGTTCCAGGGTCTCCAGGACAAGAAGGATATGGATTTCTACCTCGGTAAGAAGATAGCCTACATCTACAAGA
GCAAGTCAGAGAAGAACGGCTTCAAGTTCCGTGTGATCTGGGGCAAGGTCACCCGCGCCCACGGCAACAACGGTCTTGTCCGCGCCAAGTTCGCCAAGAA
CCTTCCAGCTGAAGCCATCTCCGCCTCGGTGCGCGTGATGCTCTACCCAAGCCGTGTTTAGATTCGTAGGACGTGGTAAATGATGATGAATACGAAAGAG
AGGGGTAAGGACGAGTTCCTGTTTTTCAGAGAAGAATCCCACCATTTCCGGACTTTTTCGCGCCTTGGCTTTCGTTGTGGCTTCCTTGTGCTTGCCTATC
GTTCGTTCATTCGTGGCAATTGACGGCATTGCTCTTGATTGGCGCTCATTAGGTCTCTCGTAACGACGCAAGAGCACGCATGACACGTAGCTCTTCGCAT
TTTGATGCTGCCATGTGGACACTTGCTACCCGTTGGTATCAAGATGTCGTAATGAAGCTCCATTCACATTTTCAGCTGAGAATGAGGAAAAACTATATGA
GGGGTGGAAGAACGTGAACGCAACAAAGCCTCGCATTGGCTTGGGAAAACAAAAACTCAAATACTATATTCTCTCTGATAAACATTCAATCAATAACACA
CGTCCAACCTCACTCTTCAAATTAAAAAAAGGAAACACACTCTACATTTCAAATTCTTCGTAGTGGACATCAAAGATTCCGGCGTACGTCTTTGCTTCGC
TCTCGACAGCATGGATCATACCCATTGGGCCAGAGACCCACGTGCCGATACCGGTCGTGCCGATCGCAAAGTTATGCGACTGCTCCTTGACCACATCTGC
AAAGAGCTCCTTCACGTTCAGGCGCGTTCTGCTCACAGGGTGCTTGAACTGCACTTCTTGGCCGTCGAATGAGAGCGTGTGCGAGTAGTTCGAGCCTCGG
TCGTCATCATTGTCGTTGCCGATTGGGCTGTTGCCATGACCTGGCGCCAACCGAGCCTTATCAACGCGACTCATGGAGCGAGGCTTTGACTCGGAAACGG
CGACAAACCACCCTGCTGCGGCGCCAACGACCATGATCAGCACCTCCATGAAACGCTGCAAAGGCCACAAGTTCTGGTCGACACGATCCGCGCCTAGGAT
TGGGTATCCGAGGCGAATGAAGTAGAGTGAGAAGAAACTGGCCGTGAAAGTCACGAAGAACATCATCATTTGACGTGGCACCGAACGGGACGCTTGGAAA
AAGGGACGCGTTGGCACCATGCTCATGTCGTCCATTGGCTTTAAAGTGATACCATTTGGGATATCGACGCCGCCAAGATGCTGATCACCGGTAAAGCACA
AGCGAACCTTAATCTTCTCATGGTCTGGGTCAAACTGCTCAATGGCGTCGAGAAGCGGCTCGAATTCATGGAAGATACCAATTTCACGCGACGTCCAATG
GAAGTACACTTGAGCGTTGACCATGTTCGGGTCGTTGTTGCGCATGCTGTCCAGGACTTTGCCTAAGATACTGATGATTGGAGTCGCGCCAATACCACCG
GCAACGAACACCAGCACTGGGTATTGTTGGAACGCATCCGTCATTTGGCCGTAGAACCCGTCGACATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCG
GCATCTTGCGTTCTTCACGAGCTTGGATCGCGAGCGCAAAGAGCGATTTCGTAAAGTTCCCGATAGACTTCACGTGCACCGTGAACGTATCTTCGTATTC
AATTGGAGACGAGCTGATACTGAACGGGTGCCATTGGGTGCGCGACAGCAGTGGGACGTGCAGGTACACGAATTGACCCGCATGGTAGTGGCCCGCTCGT
CCAGGGCTTCGGCGGAACACGAGACGAGTGATCTCACCGGGAATGGCTTCAAGATCAACGACTTCGCATGGGACGTGATTTTGACTCTTAGACATGATGC
GGTGCATCATGTAGAGGCACACGCCAGGGTACATCCAGATCACGAAGGACGAGAAGTGCAAGCACACACAAATGAGCACGACAATAAACAAATGGTGCGT
GTAGTAAAACACTTCGTAGTGGTTGCGACGAACCCAGGGGATCGACGTGAGTCCGATGATCACGCAGCAAAACAGCGCCAATTGGCCCGTGAAATTCTGG
AACCGCTTGCGGCCATCGTCACCAATGTCACAATCAAAGCACGGGAATGACGACGAGATGAACGTGCCGGCTTGGATCCACGATCGGTAGTATNNNNNNN
NNNNNNNNNNNNNNNAGGCGTGGCAGACGACCATCAAGATAGCGAACGCGCCCATCCAGCGGTGAAACTTGATAGCGTGCGCGTAGTCAATCCCCATGGC
AATCATCCAGAAGCAGTTGCGCGTCGCTGGCAGGATCAGTAGCGAGAAGCTCAGCACGGCATTGAAGCCGAACACGTAGCCCACTGTCAGGAAAGTAGCA
TCTCCGTCCGCTGCACCGACTTCGACCAGATCGTCGTATTTGCGTGAAAAGATGGCCGCGAACCAGATCGCATTCAGCCCCAGAAAGAGCAGCGTGAACA
TGGATTCCCCGTATGAGATGTTCATGCCGGCAAGCATGATCTTGCGCTTGAGGAACCGCATGAACGTGCGGTGCCAGCCGATTGTCACGGGCGGCAGCGC
GTCTCCGTACGCCAAGAAGATGCCACCGATCATCGTCGGCAGACCAACAAACACGTACACCATCACAAAGTCGACAACTTCACGATGACCGCCGACCCAC
GCTGTGCCTTGGACTTCTGCGCCAAACCATTCGTACATCGAATACCGCAGATGCATTCGGTAGTCTGGCAGCTCATGGTAGATGTATCCAAAGAGCACAA
CCGCCGCACACAGACTCACAATGACGTACGGCCAGCGCTTGTAGCTTTTCTGCACGGGTGTGCCGTACATGAATGGCGCCGCAAACACGGACGACTTGTT
GCCAGCGCTGAGCGTGAAAAACTTGCCGTTCTCGC