Description :
From Genome Similarity Track
Location :
Scaffold_2493:471- 3342
Sequence
2871 bases(100 bases per row)
GCTTGAGGCGCCCGACGTAGAACGTCGGGTGGATCTTCATCGTCGCAGGCAGATCGAGTGTGTAGGCATCGCCATGCGTTTTGCGTACTGTGAACGGACC
AATGAAGCGTGGCGCGAGTTTGGTCGCTGATGCTGCTGCGATGCCGCTCGTCGAGAGTAGAACTCGATCGCCGACCTTGTACGTCTCAAAGTTCTTCCGC
CCGCATTGATCGGCGGAAGCTTTCTGCGTATCCACTGCGCTTGCAATCGCGTCGCGCGCTTTGTGCGCGACGGATTACCGTTGTTGCACGAACGACTCGA
CGACGCCTTGCTTTTGAAGACGCTCACTTGGATCAGACGCGGCGTTATGATGACGGCGCGGCGTTTGCCTAGGTTGATGAGAGAGTTCGTTGCCCATGAG
ACCGCCGCTTGCGGTGTCTGTGCGCCTTGCGCAGCAGTGGATCCGGCTGTTGGAGTGGCAGAGCCGCGGCCGTTTGCCACCGCTCGCAGATTTGGTCCAC
GTGCTCGTCAACCGCTTGTCGACGAGCGAGCGCTGGACTGTGAGCAGGATCTTGAACGCCTTGGTCATCTAGAGCGCCTCGATCGCTTGGCGCCGGCGCG
CTCGACGTCCCTCCCCCATCAAGAGAAAGGACACCGCCGAGGCCGAGAACGGCGGAACGCGTGGGTGCCGCGCGTTGTTCACGAAGAACGACGTCAAGCC
CGTAGACGCGTGCACAGCGTTGTTCATGGCGAACTCCGCCATGGGTAGGAAGGAACTCCACGACGTGAACAACGTGGCGTAGCTGCGCAGCACGTCTTCT
AGCACGCGGTTGACGCGCTCTGTTTGGCCATCGGTCTCTGGATGCAACACGGTTGACATGAGCAGCCGCGTCCCGAGCAACTCGAACAGCCGAGACCAGA
ACGTGGTCGGAGACGATCGTGGTCGGGAGGCCATGATGACGGAACATCACGTCGAGGAAGATCGACGCTGCTACTGCAGCAAGATACACCACCTTGCTGA
ACCGATCGACGAACACGAGGATGCCCGTCCGACCGCGCGCGTCGGGCGGCAGCCCAAAGACGAAGTCCATGCTCACCGACGCCCACGCGTCGGTGGTGAC
GGGGAGTGAGCGCAGCGGCGCTTGCGACGGCGGCGCGGGCTTCACGCGCTGGCACGTCTTGTACGAGCGCACCCACTTGTACATGCGAGGCCAGTAGAAG
TCGTGGGACAGCGCGAGATACGTCTTCTCGCGGCCAAGATGACCGCCGCTCGCGCTGTCATGGTACTCATGCAGGATACGCGCGCGTACGTCGTCGTCGA
GCGGCACCACGACGCGAAAGCGCGTCGACGACGATATTCGTCGAGCCTGGCTTATAGTAGACGACGAAGTTATACTCGGCGAAGAACGACAGCCAGCGTA
TGGCGCGCTGGCTCAAGTGGGTTGACTTGGTGACCGTGCGCAGCGACGCATGGTCGGTGTACACGGCGAGCGTCTGCTCGCCGAGTAGATAGACGCGAAA
CTTCACGAGCGCATAGCGCATCGCGAGGAGCTCCTTGTCATGCACCGGGCAGCTGCGCTCGGCAGGCTTGAGCTGCTGAGACTGGTAGCTCACCACATGC
TCGCGTCCATCGTCATCGTGCTGCATGAGCGCGCAGCCGATCGCGCAGTCACTCGCGTAGTCGCTCGCGTCGCACACGACGTGGAAGGTCTTGGCGTGGT
TCGCCAACACGAGCACTGGCACGGTTGAGAGTCGCGTCTTCACTTCGTCGAACGCTGCTTGATGCTCTTGGCGCCATGCCCACGTGGCGTCCTTCTTCAG
CAGCTGCGAAAGTAGGCGTACGATGGCTGCGAAGTCCTTCGCGTAGTGATATAGGTAGTTCGCGAGCCCCAGCCACTGCCGGAGTTGCTTCGGGTTACCT
GGCGTCGGCCAGGAGACGATCGACGCGACCTTCTTGGGGTCAGCGCGGACGCCGTCCGCGCTCACGTAGCTGCCGAGCACCGGGATCTCAGGAGCGCAGA
AGATACACTTCTCGAGGTTCGCGTAGAGCTTGTGTTCGTGCATGACCGCAAACACCTGACGCAGGTGGCCGAGGTGCACCTCAAGATCGGTCGCGCCCGC
GGCGGCGCGGCTGTGCACGATGATGTCGTCGAAGTAGCTCGGCGCGAAGTCGCGCAGGGGACGCAGCACATGGGAGACCATGTGGTTGAACGTGGCAGGG
GCGTTCTTGAGCTTCTGCGGCACCACGTGCCACTCCCATAGTATGCCGCTGGGAGTGTTCACCGCCGTGAGCGGGATGTCGCTCTCGCGCATGAGAATCT
GGTAGAAGCCGTCGGTCAAGTCGATGGCGCTGAAGATCGTACTGCCTGTCATGGTGTCGAAGACCATGTCCTTGCGCGGTATCGGCGTCTGCACCGGTAC
GGTTGCGTTGTTCAGCTTGTTGAACGCGTGTACGATGCACCAGCCGCCAGTCGCCTTCTTCACGCAGAAGGTGGGGCTCGAGTGCGGCGAGATCGACTCG
CGCACGTGCCCAGCCTGATGACGCCCCTCGAAGAAGGCGTCGATCGCTTCGACTTGATCACGCGATAGTGGCCACTGCCGCGTTACGCAGTACTTCGTGC
CTGGCGCGAGGTCGATCTCGTGGCGGACCCCGCGGGCAGATTTTCTGGGAAGACGTCTGCGAACTCGCGCGCGAGCGCGAGAACAGGGTTGCCGGACGCT
TCTAGCTCGATCCACGACTGCGCCGCGTAGCGCTCGGCGCCTTCTGGACGCTCGTGCTTGGCGAGCGTTGGCGTCTGCGCCTCCTCCGTGATCGCGCAGG
TCTGCTCGATGTTGCCGCGCTTGAGGTCACGCAGCATATCCTTCATCGAGAGGATGGGTAGCTGCGTGATG