Description :
From Genome Similarity Track
Location :
Scaffold_3387:471- 1758
Sequence
1287 bases(100 bases per row)
CGGAGCTGGCAGGAAACACTGAGTTGTCGTGATCTGCAGCACTGTTGCAGCTCCCTGTACACGTACAGCACGATTCTTCACTGAAGAGCGCGTGGCTGGT
CGGGACATTcctatacatgtacacggCGTATAGGGACAAAGACTCCGGTAACCAGACCGGTTGTCCTACGCCGCTCGCCCTTTTTAGGCTTCGCATTATG
CCCGTGCTGCGCACGTAACCAAAAATTAATTAATAACACGAGCAGAAACAGCTCCTTTAGCTTGTACCGGTAGCTCCGTTCccctgctcgtcgtggcgTG
GAAATTCACGCTACCGTGTACAAGTACGAGGGAGTCGCAGtgtgctacatgtactggcGCATTTTAGACATTTTAGACGCACACAAACCGGATACGGAGA
TGCTTTTCGGGGAAGGACCAATACGGGGAGGAATCGCGTTCCTGTCATGCACCGGAACCCCAGTGTGCTCGTGCAATGCACCGGAACCTGCGAGTTGCTG
CATAGAGGGATGAGCCAGCGCTCCGTCTCGGTTAACGGATGGTCGTCGGTGCCGCGCATCCTTCATCCTTCAGTTACATGTATTACATGAGAGGTGGCAT
GCCTCGCCATCGTGTATACCGACTACGGACGGAATTATTTTATACATGTATTTTTAAATACCAGTACTGGTAGGCTACCAGTGGTAGCAGCTTGGAAAGT
GTCTTCAACCTTCcctacatgtacatgtagtacatgtattacatGTATGCATTGGGCTTTTCACATTGAAGCTTCCTCTGTGCTGCGTCCGTGCTTTGCC
TTCATGTGGTGCTCCGTATCTTGGTCAGCAACTGCtctgctgcaacagcaacgcgTTGCAAGCAGGGACACGAGTTCACACAGCACAGTATGCGGTGTGC
TGCACACGTAGAGCCTCAGCCGCTTCTAATCTCTGGCACTGATGCAGCCAACGACAATGATGCTCGCCGACGTGACTGCTGCGCACGAGCACTTGCCCCC
AGTATGTTTGTTACGAAAAAAGAGCCGCCAAGCGCATCGGCTCTGTTCGAGCGGGCTCAAACCAACGTCCTACGAGCGCGAGAAAGGCAAGTCTGCATTG
GCGGACCCGAAGAGAGAAATGGCCAAGTCGCTCTTCGTTTGAGCCTCGCCCGGGAGCTGGTTTAGCTAGCTCACTTTGGAAATTTTCTTCTCGCGGTAAA
GTctcagcaagcagcagcagtcccGCATCGCGTCGCTCGACCTTCTTCCTTCGTTCGTTCCACGATGTCGACCGCCAACGGCAAGTC