Description :
From Genome Similarity Track
Location :
Scaffold_23:470978- 473485
Sequence
2507 bases(100 bases per row)
CAACGACGACGCCTCCGCCGAGCGTCGGATCTGAACCTGGTTCAGATCGACGTCGCTTCAAGCGACTCGAAGTCCAGGGCCCGGGCTCCTCCGACACGGC
CGGTGGAAGTGTGTTATCACATCTTCGATGGCGGGACCGGTTTACCCGTCAAGGCATCTGGTGTCCATTTGGAACCGTTGCCAGAGGTTGCCGAGATACT
GAACCTTAAGGAAATGATGGTCGAGGCTTTCCTGGCCAACCTCAAGGCTGGAAAAGGTTGCCGAGATGGTGCTCATAAGACCTGAGACCACTCGGGAGGA
GCTGAACGCCTCCTCTGTTTTTAACGAGGACGTCCTGGAGGACCTAAACAAGCAGCATCAGACGCGCTTGGGTTCCGAGATCCTTAATAACCCCAAGGAT
CCGGTGTGTCCTTTGGTGACGGAGTATGCGGACGGGATGAACAAACACCCACCGACCCAGCTCCCACCAGATCGAGGCGTACGACATGAGATCGATCTCG
TGCCTGGCACAAAGTACTGTGTCACGAGACAATGGCCTCTTCCGCGCGAACAGTGCGAGATCATTGATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCAT
GGTGCGGGAGTCGAAGTTCCCGCCCTCGACGCCAAATTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCATCTAGTTCATGCTTATAACAAGCTGAACAAC
GCGACGGTGCCGGTCCAAACACCAATCCCGCGAAAGGATGTGCTGTTGAACAACATGGCCGGTAGCGTACTTTTCAGTGCGCTGGATTTGGTAGACGGAT
ACTACCAGATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTT
TAATGCCCCGGTGACGTTCAACCACCTGGTGACGCAGTTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCAAAGCCGT
GCCGAAGGAGGCAAAACGGCCATGGAGGTGCACCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGTTCTACGCCAACATCGACAAGT
GCGTCTTCGCGTCACCAGAGATTAAGGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCC
AACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACACGGGCTTCGCTGAGCCCTTGTCG
GGCCTCCTTAAGAAGGGCGTCGACTGACGCTGGGAGCAGGAGCACCAGGATGCCTTTGACAGAATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGACCC
TGCCAGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGACTGTGCCATCGGTTGTGCACTGCTGCAGGCCGACACGGCTGGACATGAACGCGT
CATATCGCTTCAGTCTTGGCAGCTCAAATCCGCCGAACAGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGT
GTTCACCTTCTGGGCTCCCGGCCCTTTGTGATCTACACAGACCACACGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAAGATGGGGACGT
GGCTGTCCTACTTCGCGGAGTACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGTGGACGCCCTCTCTCGGCGTCCAGACTACGAGTT
GGCCCACATCACACGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCTTCACGGCA
GGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTACCGGGTGGGGCCCA
ATGAACCTCCACGGGTGGTCGTACCCAACGACAAGGATCTGAAGTTCGACATTCTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGGGCCGCGA
GAAGACCTTTCTGTCGGTATCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACATGAAGACATATGAAACATGTCAGCGGGTTTAA
CCCGCAAGGCACGCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTTGATGAGTCTTGACTTCATCTTTGGGCTTCCCACCGACG
GACACGGAAACACCAGAATTTTTGTGTTCGTGTGTCGGCTGAGCAAGATGGGACATCTTGTTCCGGTCCCCGTCACTGTTACGGGCGAACAAACCGCAAG
GTTTTTCGTCGATGGCGTGCTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACGGCTGCTTTTTGGAAAACGCTGTTT
CCTTTAC