Description :
From Genome Similarity Track
Location :
Scaffold_465:4709- 7874
Transcript NameFunction/comments
g12062.t1hypothetical protein
g12063.t1ETI34642.1 hypothetical protein F443_18889 [Phytophthora parasitica P1569

Sequence
3165 bases(100 bases per row)
CACAACTCAATTTCTCCTCTTCCTCGCAAGTCTTCTTTCCAGCAGGCTAACCCCTTGATAGGTTATGAGCCCAACACACGCGTCGCCCACTGACGACCGT
GACTTCCAGCGCCTCAACGGCCGGAACTTCGTGACCTGGAAGACACGCGTCACCGCCGCACTCGAAGGCAAGAAGCTCATCGGCTTCGTCACTCAAGCCG
TCTACGCGGGAGTCTGAATCCGACTTCAGCGACGACGATGAGCTCGATCCCAAGTACTCCAAGTTCTTCACGGCTGAGGACAACCAGACTATCAAGACGA
CCCTGGACGAGATTGGCGCTCCAAGTGCAGATGCATCCAGCTCCTCATCGAGTGAAGCCTCGGGCGACAGCACCGCTGTGGCCAATGAAGATGGAGACGG
AGAGATTGAGATAGACCAGGAGAATCTCCGTGTGATCCAGTCCTTCACTGTCAAGAAGCAGCTGGACCGTCAGAAAGCAGAGAGGCTAAGGGTCCGACGC
CCCAAGCTGAGCTCCAAGACGCTTCGCCGGATGGATGCGAAAGCTAAGGCGTTTCTCATGAAGACCATTGACGACCAACATGTCCTCATGATCAAGGAGA
AAAAGACGCCGTACGAGATCTTCACGACTCTGTGTGCCATGTACGAGGACACTGCCATCCACAGAGACCCGTACTACATCATGAACTATCTGATGGCTCT
GTAGTACAATGAAGGTACCGATCTCAACAAGTTCATTTACGCGGTGGAAGAGGGAATGAAGGCAGCCTCCGACACCACCACAGCGTGATGACAGATAAAC
AAAAGACCATCTACCTGTACCACGCCTTCCCTGATGTCTGGAAAGTTGAGATGGCAGATTGGAAGGGCAGTCGCAAGTATGTTCCATACGAGGAACTCAA
GCGGCACATTGAAACCAAGGTCCGCAACGAGATGGAGCGCAGTCGCTACACTCTAAAACAAGGGACCCCAGAATCTCGGGAGACTCAAGCTGAAAACGCC
CTGCAAGCTGAAGCGCCAGCTAAAGTGGAATTCCCACCGAAGAAGGCGACAGCTCTTGTGACGGCACACAAGTGCTCATACTGTGGACGCGATAACCACG
ACACGGTTGACTGCTATATTCTGCAGCGTCATATCCAAAGCGGCCAAGTCAAGGAGGGAACCATCCTACCAGCCAAGTTCAAGCTGAAATCTCTTCAAGG
AACGCAACTCCAGCATTCTTACAAGGAAGACTACAAGAATCGCGGTGGAGACCGCCAGCCTCGCAGCCACCACAACAATGGCCGCGGAAACGACAACCAC
AACGAGAACGACAGACGCCACAATAATCGTGGACGCCCCGACCGTCATGGCCATCAAAGCTTCGACAAGTTCCACGGAAGACGCAACCAAAAAGGCAACG
GCTCTGACAGGAGCGATTATGGCATCATTGCTATCACCACGCTTGATCTGACTCTGATGAAGAACAAGATCAGGCTTACGGCTCAAGATGGGCCCCATGA
CCCCGCGTGGACGATCGACTCTGGTTGTACCCGCCACGTCACGTCCAGTTCGCACTGGTTCGAGGACTTGAAACCCATCATTGGTAAAACCATCATTGTT
GGTGGAAACCACTAGATCCCAATTCTGGGCACGGGCACTGTGAACATGACTGTCACCGACACCAAGGGAAGCAAGCGCATCATTTCACTGAGCGACGTGC
TCTACGCGCCCGAACTCAAGTTCAATTGCTCTCGGTGCGCCAAGCTGTTGATGGAGACTACAAGATTAACTTCCCCAACGCCAAGAAATGTGTTCTGTTC
TACGCTCACCATACCAAATTCGAGGCCTAGACTGGAGAAGGAACCAACCTGTACCTGTTCAAGGCCCTCCCAACTGACAGTGACCAAGCGGCCCACGTGG
CCAACACAGGTATGTCGATAACATCATGCTCTGACACAGACGAATGGGTTATTCTAACTTTCGCATTATGCAGGATCTGGCTAAGACCGACAAAGTTAAG
GACATGGGACTGTCGAGATTCGACTCCAGCAAAGACTACTTCTGCTCATCATGCACATACGCAAAGTCGCACCGTAACCCGTTCAATAAACGATCCGTTG
AAAGGGCGAAATTCCCTCTTGAAAAGGTCCATACCGATATAACTGGACCATTGCTAGTTGCAACGCTCTCGGGCTGCCATTACTTTCTCACTTTCATCGA
TGACTTTTCACGCTATATGTTTATCTACATCATCAAGCGGAAGTCAGACCTCTACGAATGCTATTAGAACTTCAGAAGGAAGCTCGTAACGTGTTTCGCG
CTGACGTAGGCCAGATCGAGTACACCGAGAACATGTACGATGAAGAAATCCGTCACCTCCAAAGCGACAGCGCCCGAGAATACGAAAAGCTCGGTCGAAT
CATCTTTGAGAAATACAACACACACACACAATTCACGAATGCCTACACCCCTCAGCAAAATGGGGTCGCAGAGCGAAGGATGCGCACACTACTTGAACGA
GCACGAGCCTTCCTAATTGATGGGAACTTACCGCACGTTCTCTGGGGAGAATGCGTGAAACATGTCACTGATCTCCTGAACATCACTCCAAGTTCTGTTA
CGGACAATATCACTCCCCAGGAAAAGTGGTTCAAGCGCAAACCATCCACACACTACATCAAAGGCTTTGGGTGCGCGGCATATGCGCACATTCCAGAACT
CTATCGAACCAAATTCGAAAAACGAGCAAAGAAATGCATATATCTAGGTATTCCGTCGAATAATAAGGGGTACAGTCTTATCGACATGACCGAAAATCGG
ATAATCTACAGTAGGGATGTTCAGTTCCGAGAATAGGAATTTCCTAAGATAGAGTTTCTTCAATCTCCAACCACGGGAGACCTACTCAGACCTAGCGCTG
AAACTACAGCACCCACACGACAACCACTACCATCTATCGTTGAAATGCTCAAACGCAGCGCGACAGCACTTGCAGCTGACGACAGCAAAGGTTCGAACAA
AAAGGCAAAACACGCCCAAGAACACATGGATCTAATACATCCCCTCAATGATCAACTCGATGTGGAGGAACGACGAGCGCTGGAGAGACAAACGCACTCG
TTGCTGGCGATCCGACACATTTCGGAACCAAAGACATACCGAGAAGCAATGCGTCTACCGGAAGC