Description :
From Genome Similarity Track
Location :
Scaffold_361:47085- 48088
Sequence
1003 bases(100 bases per row)
CGTCGATGAACGTGACAAAGTAGCGTTTGCCACTGAATATCGACGTCTGCATGGGACCACACACATCACTGTGAACGATTTCCAGCAGTTTCTTGGCGTG
GTTGGGTGACTTGGACATGTAGCTCACTCGCGTTTGCTTGCCGAGTGCACATCCGTCGCACAGCTCCCACTGTTTCACCGACGTCATGTTGATACCTGCA
CCGTAGTCCTTTTTGACGATGACGTCTAGACCGCCATGGCCAATGTGACCAAGTCGAAGGTGCCAGAGGTACGATGTGGTGTCCCCTTTGCGATCCTTCG
AGCTTGCCGCATTGGCCTCGTCGGGCACAACTGGTGTCATGCACAGCTTGAACAGCCCTTTGCCTTCACGCGCGCCGAGCTTCCAGTTAAGGCCCTTTGC
TTCCGCAAAACACCCATCCGTCTCGAACGTCACGGGACCAACATCCTTGGTGAAGCGACCAACCGAGAAGAGGTTGCGTGACAACTTAGGAATGTGCCAC
ACATTCGTGAGCACACCCTTCTTGGTCCCCCGTGGAGTCTTCATGGGCATCACGATGTCACCGGTCCCGACCGCCTGAACTACACCATCGTCCGCGAGAT
GCACGTCCACTGGATACATCTTCTTTTAGTTCTTCATGTACTCCTTCGAGTACGTCATGTGCTGTGTCGCACCCGAGTCGACCAGCCACTTGTCACTTGA
CTTGGTGGTCTTGCTCGCACCACCAACCACGACGAGAAACTCACCCGATTCTTCTTCATCGCGCGCGACGTTTGCTCGTTGCGGCCTCTGCCGCTCCGCC
TTTTCACGAATCCTCACCGGACACTTGGCGATCCAATGTCCTTGTTCGCCGCAGTAGTGGCACGCGCTTGTCTTTGGCGCCTGTCGTCCCTTGCGCTTCC
CGCTGTCACTCGTCATGAACGCTTGACCGTGCGCGGCGCCGTCCGCACCGCCACCTTGCTCTTTGCGCTTCATGTCCTCATGCAGCAGCCGAGCCGTCAC
GAG