Description :
From Genome Similarity Track
Location :
Scaffold_122:47082- 48478
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_14273dynein heavy chain

Sequence
1396 bases(100 bases per row)
GCCTCGTGATGAACTTTAGCTCGGCCACGTCGTCATCGACGACCCAGGACGTGATTGAAGCCGTCATGGAGAAGCGCAGCATGAACCGGTTCGGCCCCGT
CGGCGGCAAGAAGCTGGTGACGTTCGTCGACGACCTCAACATGCCAACCAAAGACGACGTTCGTCGACGACCTCAACATGCCAACCAAAGACGACTTTGG
GTCCCAGCCCCCGCTCGAACTACTGCGGCAGTGGGTCGACTACGGCTGCTGGTACGACCGGAAGAAGCAGACGCTGCGGTACTTCGTGGACATGCAGCTC
GTGGCCGCCATGGGACCACCCGGCGGCGGTCGGTCCGTGATCTCGTCGCGCTTCCAGAGTCGCTTCAACCTCGTCAACATGACGTTTCCCGAGAACACGC
AATTGCGCAAGATCTTCGAGACGATGCTCGTGCCCAAGCTGAGCGAGTTCGACGACGAGATCAAACCCCTCGGCGCGCCGCTCGTCACGGCCACGATCGT
GCTCTACCAGACCGTCGAAGCGAACTTTCTGCCGACGCCTGCCAACTGCCACTACCTCTTCAACCTCCGCGACATGGCCAAGGTCGTCCAGGGCCTTTTG
ACCGCCGAGAAGCTGCTCATTTCGGGTCGCGACGGCATGCTCCGGCTCTGGATCCACGAGGCCCTTCGCGTCTTTAGTGACCGGTTGACGTCCGCCACGG
ACCGCGCGCTCTTCAAGGTACAATCGTCTCGAGTTCGCGTCTCTATAACCTTGTCTAGACCAAACTGGACGAGATCCTCGCGGCGACGTTCCAGACCGAG
TGGAACCGGCTTCTCAACACGCACGTTGAAGTGCTCAAGGAGAGCGGGCCGCTCTTCAGCGGTATTTTGACACCGTCCGAAGACGACGCGCCCGTCAAGT
ACGACGAAGTCGACGACATCAAAGGCCTCAAGCATTTCGTGGAAGATCAGCTCGACAACTACAACGTCGAGCCGGGTCTCGTGCCAATGGACCTCGTGCT
CTTTGGTGACGCGCTCATGCATCTGCTGCGCATTTACCGGCAGCTGACGACGCCGCGCGGCAACCTCCTGCTCGTCGGCGTCGGTGGCAGCGGTCGGCAG
AGTCTGACGCGCCTCGCAGCGTTCATTGCGAGCTGCGACCTCTTCCAGATCGAAGTGACCAAGAACTACCGCCCGATGGACTTTCACGAAGACATGAAGA
AGCTGTACCACAACACGGGCGTCCTGAACAAGAAGACGACGTTCCTCTTCAGCGACACGCAGATCAAAAGCGAGTCGTTCGTCGAGGACATCAACAACAT
TCTGAGTTCCGGCGAGGTATCCCGTGTTCAAATCTGGTTGATAGCGCTGAGTTGTACACTAGATTCCAGGCCTCTTTGAGAAGGACGAGCAGAGTA