Description :
From Genome Similarity Track
Location :
Scaffold_171:47082- 48383
Transcript NameFunction/comments
Physo_144182extracellular endo-1,5-alpha-L-arabinase, putative

Sequence
1301 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGTTGCAGGATCTATTTGACATGCCAGTCCTGCCCCAAGCCTGCACGCTCTCAAGG
CGGACTGCGTGGATCACTGCAGTCTGACAGCCAAACTACGACATAAAATTCAGAGCAAATGTGTCGCTCCGCTGCAGCATCAGCTGGGATAACGCCCTTG
CTGGGCTGTCCGAGCTGAACTCTCTCGAGCATTGGAGATGATGGCATTTTCACTTCTGAGCTCACAGCCACACGCGGTTCCAGCATCGATCCCCCCATTT
TAACTACCATGAAGCTCCTTTCGATTCTCGTCGGTCTTCCCCTCCTCGCCGCTGGCGTCGTCAACGGATACGCCAACCCGCAGACGTGCACGGGAGTTTG
CACCAACGCCCACGACCCGTCCATTATCCGCCGCGACGACGGCACGTACTTCCGCTTCTCGACGGGCAGCAAGATCGCCATCCACTCTGCGCCAGCGCTG
ACAGGTCCATGGACGTACCGCGGTGCTGCTGTGCCGAACGGCTCGAAGATTAACCTGAAGGGCAAGGACGATCTCTGGGTAGGTGCCGTGCAAAAGCATA
TCGTATAGATGTTAGTGGTGCTAACGCTTTCATGTTGTTATTCCCAATTAGGCCCCTGAGGTGAACAAAGTCGGCGACACGTATTACCTGTACTACTCGG
TCAGCTCCTTTGGCACTCAGAGCTCCGCCATCGGTCTGACGCGGTCGAAGACCATGGAGCCTGGCTCGTGGGTCGATGCGGGCAGCGTGGGCGTCACGAG
CAATGCGTCCAAGAAGTACAACGCCATCGACCCGAACCTGATCCAGGTCGGCAGCCAGTACTACCTTAACTTCGGCAGCTACTGGCAGGGTCTTCACCAG
GTGAAGATGTCCACGGTCCCCGCGAAGAGTACGGGCGCCTCAGCAAACCAGATCGCCTTCACTTCCAACTACGAAGTGGTCGAGGCGGCGTTCGAGTTCG
CGTACAACGGCTACTACTACCTCTTCTTCTCCAAGGGCTCGTGCTGTGGATATGACAAAACTCGCCCCGCCAAGGGCAAGGAATACCGCATCCTCGTGTG
C