Description :
From Genome Similarity Track
Location :
Scaffold_59:47080- 50820
Transcript NameFunction/comments
Phyag_g1382hypothetical protein PHYSODRAFT_361180
Phyag_g13835'-AMP-activated protein kinase subunit beta, putative

Sequence
3740 bases(100 bases per row)
GCCTCTTCCAATGTAGTGACTTCACCCACTGCCAACAGTGCACGCGCACAGGAGAGGAAGCAGCGTGCAGTGGCGCCGTACGCACAGAAGGAAGGCATCG
CACGCAGCCGACGCATGTTCGGTGCGTTGATGGGGCATCTAGGCAAGGCGAAACGGCAGATTGAGAAGGATACGGACTTGTTTAAGCGTCaggacaccaa
gcagcacgaggctGAGCAGAGGGAGAAGATGCAAAGCCAAGATCTCGAAAATCGCGCGCGTCGTGAAGCCGAGATATTGAGAttggagacgctggtgaCG
CGTACTGAACTGGACCGCAGCGAGCAGATTGCTCGTGCCAAGCTCGAGCACCTGCAGACTGTCCGGAAAAGTGAGAGTCAGTCGAAGTTTCTGGTTACTA
TTGCGTCGCCCCCTATCTACTATCTTCCATCGAAGCACACGAAAGAGACCAAGGAACTTGTGGCTGCATCCATGGAAGCCCATGaagcgaagatgaagga
tAGTGGGCGGAGTCACGAGGAAAAACTGCGAAAGCTGGAAGCAGAATTTGCAACCAAGttggagcagcttcgtgaggAACTGGAAACGCTAAAGAACGGT
GAAAAGGAGAAAAGTGGTGAGCAGGCGTCACCTAGTGAGAAGAACGACGATGCAaggcaagacgctgacgcGGACATGGATCGTGCCGGCAGCGAGCGCG
ATGAAGAAAAAGATGAACAGGAAAATGCAGACGAAGGCACGGAAGTCACTGACGGATCATCGGCCAtagaagttgaagacgaagataTTGGCACGGAAAG
TCAAGCAGACAACAACAGCTCTGCTGAAACAAGGAGGAATAATGACGGAGAGAAGGAAGATAAGACTACGGTCAAGTCGGATTTGGAGCATGGCAGCAAA
GGCGAACGAGACGCCTCTCCTCGTAAAATTGAGAACGGTACTAACAATACGGAGGTGTTATCTCCCAGTCAAGTCAAAGAGGAAGAGGTAAAGGAGCAGA
GCGAATCTGAGGAACCAAAGCTGAACGACAAGGCTGAGCAGACTGCCATCACGAAGGAGAGTAAGGAAGCTGGCCCTGAAGTGCAGTCCGACGCCGAAGT
TGCCGAAAAGGACGACAGTCCGAAGCCGGAAGACGCCGCGTCTGAAACGCCGAAGGAAGACCCAGCAGCTTTTGTTGACAAACTGAAGGTGACCGAGCTG
CGAGCTGAGCTCAAAAAGCGAGGACTCGACATCAAGGGCCTCAAAGCCACACTCGTGCAGCGACTCCAGCAGGCGGTGCGTGAAAACGGACCCTGAGTTC
GTATTTATGCTGGCACAAGCAATATACACCAGACCTTTATCGACCTtcatcatcgacgagttcacTTCAACaaaatgtatccatctctCAAAACATACCT
ACCTTACAGCATGCATCCTCTCTTATTTCATACGACCTCATCATACGTGTCAGTCAAGCAGATCTCGATACTTCGGCGCTACGATGGAAATGGTGTGTAG
TCTCTGCGTGCATCGCCGTGCttgtctgcagcttgtgaCCCTCTCTATTGCGTCTACCTACTGCAGGAAATCCCCTACACGAGCCCTGTGGACCCGGAGA
GCTACGGCTTCCTGACGGTCGTGCTGCTACTGACTGGGCTGGTCTTTatgtcgctcttcttcacgcgcGCTGTggcccccaagaagaacgctctggtgga
gctggtgctggcctTTAtcgctgctctgctgctgggcttcgGCTCGcttttcctcttcctctgGGCTGAGATCTACGTATAATCAAATGACACAGTCAAG
CAGCGTCGATGGCTCAGCCAGAATGAAGCTCGTTCCAGCGATAGAAGGCGGAGAtgacaagatgaagaagcagaacggATGCAGTTTTGACGGAGAGGAA
CTTGCTGgcaggaagaggacgatacggtggagcagcaggtcgcCAAATTGAAGTAGGAACATCGTCCTGGGCGCTACGCGGATGCTGCGGAAGAAGACAA
AAATATGTTTATTGTTTTTGCGCTgctcgttgtcgctgtgtATTCATGCGTCCGTGGGTGTGTGTGAAGTGGCAGTCGATGGTGGAAGGACGAGCTTCTC
ATTGGTTTAGGCTTCGCCGTTCCTAGGTTGGCCATGCCCTGCCGCTTTTGCACTCACTGTTACGCTCTGCTCGCTACGACATTGCGAGCTGCTCCTTACA
AAAAAAAAGAGAGATTTGCTGTCTACTGCCTACAGAAGCCGAGCGAGGCATGCGCACTGCATGCCCACGCCGCGTCCAACACTTGGATCATTCACGACTG
TGCTCCGAGCTTCCTCCCGCTTGTCTACCTGTGCTGCCTTCTACGTTGGATCGATTTTCCAGATCAACCCGACCACCTGCCCATCGACCGGCCTAACCAG
TGCATGGAGTAAGTGCGAGCTAGTTGGCGCCGGGCATGAGGCTATAATAAACGGTGGTCACGAACTTCTGCTTGTAGCGGTTGGTGATGCCGAGCACCAT
CATGCCGTCCTTGATGGCTGTGCAGTAAAGATGGTTGAGCGCCACGTGCTGTGGCACAGGCAGCAATCGTCCATCGACTGTCGGTGGGGCCTGAACAAAC
AGCGACGCAAAAACACGCGGGTCAGGACCAGCACAACCACTACCACAAACACACACAGGTAACTTGGCTTACCTTGTTCAAGATAATGTGCCGCAAGTGC
GGCGGAAGCGGAGGCGGCTCCTTCGTGTACTCGTCGATCTCGGGGATGTACTTTGAGTACGGGTTCTCGggatcttcgtcgtcgtcctgggCCTTGTTCT
TGCCGTCAAAGTCCGAGAGCGGCGCGAAGTCCGACACGTCCACGTAGTTGTTTACGTTGCCTTCCACGTCTGCCATCGTGAGCTGGTCGGGGGCGAACCG
ccagtcgtcgtccaccacgaactTGTACATGTGCTTCCCCCGCGTGAGGTTGGCGATGTACGTAAAGTCGTTTCCGGATCTGTGCATGGGGCACTGCTTG
TCCCAGCCGTTGAAAGTGCCCGTGATGAACACGTTGCGTCCTCCGTGCTCCCACTTGAACACCATCGGCACCACGTCCTCTCCGGGAGGGACTGTGACGT
CCGTTGTCTGTGTATTACTCCCCTTGCCATGTTCCGCGTCGTTCTGTGTGTTTGCCATCTCTCCGTCTACATCTGAGGAGGATTCGGTGGGCGGATCCAC
TTCCATGGCTTCGGTAGCGTTATGCTGCGTTGCGTAGTACTGCTCGTGGTCCTGCGGGTGCTTCCCGTCGCTATTGCCACCGTCGAAGCTGCGTCCTTGC
TGCTGAGACTGCGCCTGATTGTAGTACGGATGGTGGTGCAATGGGAACGCGTTCGGGTCGTTCGGATCCGCGCCCAAGTTCTTGGGGTTGGCGTCGCCTG
CTTTGCTGCTCGCGCTGCCCAttgctgctcgccctgtGGACTGCTGACGACGGCACTCTCGGTGGTAAGTTTTGTAGGCGGATCAGCTGAGCCGGCGCGT
AGATCGAGTGGACTGGTGCTTGGACCCTTGCTCGCGGCGGGTGCGCTTCTCTTCCGGGGCGAATGCTGGCTTCTCTCTATTACAGAGGCAAATCCGCCTG
AAGCCCCAGCCTCAACGGCGACGCATCACCGTCTTTAACCGTCGGTTGTGTACACGAACACAAAGTCCACGAGACTCGCGATTTGTATAGTGATACCGCA
CAGTTGATATCATAAGCCAACAGAAAAACACGTCCGAGCt